ID: 1152138691

View in Genome Browser
Species Human (GRCh38)
Location 17:78523487-78523509
Sequence AGGGACTGTATATGAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152138688_1152138691 14 Left 1152138688 17:78523450-78523472 CCTTTTCAGTTTGTTTTTATTGT 0: 1
1: 0
2: 11
3: 192
4: 1962
Right 1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1152138687_1152138691 19 Left 1152138687 17:78523445-78523467 CCTCTCCTTTTCAGTTTGTTTTT 0: 1
1: 1
2: 9
3: 155
4: 1807
Right 1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1152138685_1152138691 24 Left 1152138685 17:78523440-78523462 CCCTGCCTCTCCTTTTCAGTTTG 0: 1
1: 0
2: 4
3: 47
4: 513
Right 1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1152138686_1152138691 23 Left 1152138686 17:78523441-78523463 CCTGCCTCTCCTTTTCAGTTTGT 0: 1
1: 0
2: 3
3: 54
4: 658
Right 1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152138691 Original CRISPR AGGGACTGTATATGAATAAC TGG Intronic
900010193 1:99787-99809 AGGGAGTGTATGTGATTAAAGGG - Intergenic
900026300 1:276350-276372 AGGGAGTGTATGTGATTAAAGGG - Intergenic
900036085 1:410186-410208 AGGGAGTGTATGTGATTAAAGGG - Intergenic
900057709 1:645938-645960 AGGGAGTGTATGTGATTAAAGGG - Intergenic
901735896 1:11311990-11312012 TGGGACTGTAGATAAATGACTGG - Intergenic
908969925 1:69815815-69815837 AGGTACTGTCTATGAGGAACAGG - Intronic
909924170 1:81419088-81419110 AGGAACTTTCTATCAATAACTGG + Intronic
911531440 1:99047977-99047999 AGGGACTTCATATGAAAACCTGG - Intergenic
912869732 1:113293077-113293099 AGGGACAGTCAATAAATAACTGG - Intergenic
918656714 1:187035829-187035851 TGGGACTGTATTTGAATATAGGG - Intergenic
919422954 1:197393867-197393889 AGTGAATGTATAGGAATAAAAGG + Intronic
920087020 1:203424886-203424908 ATGGACTGTAAATGAAGAAGGGG + Intergenic
922258629 1:223915771-223915793 AGGGAGTGTATATGATTAAAGGG - Intergenic
922482087 1:225946000-225946022 AGGGACGGTGTTTGAAGAACAGG + Intergenic
923966433 1:239145421-239145443 AGGGACTGCATTTGGAAAACAGG + Intergenic
924027094 1:239845227-239845249 AGGGACTTTATATAAATAAGAGG + Intronic
924339820 1:243018531-243018553 AGGGAGTGTATGTGATTAAAGGG - Intergenic
1063737055 10:8769737-8769759 AGGAACTGTATATGGGTAAGTGG + Intergenic
1065372237 10:24999068-24999090 AGGGACAGTATCTGACTAATGGG - Intronic
1067751112 10:48971867-48971889 AGGGACTGGAAATGAAAGACTGG + Intronic
1068334500 10:55614807-55614829 TATGACTGTATATGAATGACTGG - Intronic
1075569343 10:123528246-123528268 GGGGTCTGTATCTGAATATCTGG - Intergenic
1075581637 10:123623227-123623249 AGGTGCTGTCTATGAAGAACAGG + Intergenic
1076490529 10:130858458-130858480 AGGGGCTGTGTATAAATAACAGG + Intergenic
1077255270 11:1578963-1578985 TGGGAATGTATAGGAATAATTGG - Intergenic
1078967960 11:16369726-16369748 AGAGACAATAAATGAATAACTGG - Intronic
1081153667 11:39663510-39663532 AGGGTATGTATATGTAAAACAGG - Intergenic
1081278119 11:41176097-41176119 AGTGACTGCATGTGTATAACTGG + Intronic
1081839145 11:46183318-46183340 AGGTGCTGTGTATGAATAAAAGG + Intergenic
1082208321 11:49466493-49466515 AGATACTGTATATGATTTACAGG + Intergenic
1086004634 11:82023881-82023903 AGGAGCTGTATATTCATAACAGG + Intergenic
1086262564 11:84958201-84958223 AGGAAATATATATGAATAAAGGG - Intronic
1086641209 11:89158165-89158187 AGATACTGTATATGATTTACAGG - Intergenic
1095457217 12:42400930-42400952 AGGGACTGTATTTGAAAACATGG - Intronic
1096535453 12:52269757-52269779 AGGGACTCTACATGAACAAACGG - Intronic
1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG + Intronic
1099098782 12:78410401-78410423 AGTGATAGTATATAAATAACAGG + Intergenic
1099325667 12:81211612-81211634 AGAGGCTGTATTAGAATAACTGG - Intronic
1101250179 12:102926057-102926079 AGGCACTGTTTATGATAAACAGG + Intronic
1105929242 13:25036773-25036795 AGGGACTGTTTAGGTAGAACTGG + Intergenic
1111466580 13:88620924-88620946 AGGGATTGTTTATGTAAAACCGG + Intergenic
1111529617 13:89519805-89519827 AAGTACTCTATATGAAAAACAGG - Intergenic
1117543188 14:56768730-56768752 AGGAACTGGAAATGAATTACAGG + Intergenic
1117885308 14:60355205-60355227 AGTGACTAAATCTGAATAACAGG - Intergenic
1118131974 14:62976441-62976463 AGGTACAGTATCTGAATAAAAGG + Intronic
1119372805 14:74162021-74162043 AGAGACAGTAAATGGATAACTGG + Intronic
1120601200 14:86512088-86512110 AGGGAATGTATTAGAATATCAGG - Intergenic
1121498648 14:94415863-94415885 ATGTACTCTATATGAATGACAGG + Intergenic
1122102339 14:99423004-99423026 AAGGAGGGAATATGAATAACTGG - Intronic
1124145701 15:27123457-27123479 AGGCACTGTCTATGAGGAACAGG + Intronic
1125156874 15:36597695-36597717 AGTGACTTTAGATGAATAACAGG - Intronic
1126838797 15:52695646-52695668 AGGGACAATAAATGAATAAATGG + Intronic
1126978397 15:54212408-54212430 AGTGACTGTATATGATTCTCTGG - Intronic
1127028604 15:54835617-54835639 TGAGACTGGATATGAATAAAGGG - Intergenic
1134402340 16:13921016-13921038 AGGATCTGGATAGGAATAACGGG + Intronic
1136105817 16:28029652-28029674 ATGGACTGTAGATGAATGAATGG + Intronic
1142454145 16:90207133-90207155 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1143569307 17:7744938-7744960 AGGGATTGTATTCAAATAACAGG + Intronic
1145800596 17:27681578-27681600 AAGGACTGTATTTGACTAATGGG + Intergenic
1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG + Intronic
1152632959 17:81418926-81418948 AGGGACTGTGTGTGACTCACGGG - Intronic
1153209238 18:2741724-2741746 AGGGATTGTTTATTCATAACAGG - Intronic
1164863718 19:31585324-31585346 AGGGAATGTAAATTAATAAAAGG - Intergenic
1164911830 19:32018990-32019012 AGGGGCTGTATCTGCATAGCAGG - Intergenic
926453628 2:13038003-13038025 GGAGACTGAATATGAATAATTGG + Intergenic
926876111 2:17481076-17481098 AGGCTCTGTATAGGAATAAGAGG + Intergenic
926882451 2:17561796-17561818 AGAGACTGTTTATGAATGATTGG + Intronic
926988996 2:18656775-18656797 TGTGACTGTTTATGAAAAACTGG - Intergenic
930981327 2:57529406-57529428 AAGGACTGGGTATAAATAACTGG + Intergenic
935234303 2:101125252-101125274 AGGGAGTGGTTATGAATAGCAGG - Intronic
939581962 2:143961197-143961219 AGGGAATGAGTATGAATATCTGG - Intronic
943854953 2:192777479-192777501 AGGCACTGTTTATGTGTAACAGG + Intergenic
947064383 2:226205321-226205343 AGTGAGTGTAAATTAATAACAGG - Intergenic
948324129 2:237098149-237098171 AGGCACAGTATCTGAATCACTGG + Exonic
949085598 2:242151795-242151817 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1178014653 21:28329926-28329948 AAGGCTTGTATATGAATATCAGG + Intergenic
1182109061 22:27710122-27710144 AGGGACTGGGTGTGAATGACGGG + Intergenic
1183169046 22:36171302-36171324 AGCCACTGTATGAGAATAACAGG - Intergenic
951223345 3:20092998-20093020 ATGGACTTTATGTGAAAAACTGG - Intronic
956755314 3:72380371-72380393 AGGGACTGGAGAAAAATAACTGG + Intronic
957401900 3:79726267-79726289 AGGGACTGTAGATGAACCAGGGG - Intronic
958106822 3:89085041-89085063 ACGGAGTGCATGTGAATAACTGG - Intergenic
960867410 3:122215860-122215882 AGAGACTGTATCTGAAGGACAGG + Intronic
962451445 3:135520780-135520802 AAGGACTGTCTATGGATAATGGG - Intergenic
962595448 3:136938243-136938265 AAGGACTGTATATGAGTAAGTGG - Intronic
965838096 3:172873130-172873152 ATGTACTGTAAATGAAAAACAGG + Intergenic
969451806 4:7278127-7278149 TGGGGCTGTAGATGAATAAGAGG - Intronic
970264986 4:14272327-14272349 ATGGCCTGTATTTGAATAAAAGG - Intergenic
971463862 4:26933433-26933455 AAGGACTGTATTTGAACCACAGG - Intronic
971795588 4:31223301-31223323 AGGGAATGTTTAGAAATAACAGG - Intergenic
972951641 4:44332245-44332267 ATAGACTGTATTTGAAAAACAGG - Intronic
974384861 4:61191088-61191110 AGGCAGTGTATAGGAAGAACTGG + Intergenic
975672861 4:76799054-76799076 AGAGCATGTATATGAATAACTGG - Intergenic
976609479 4:87015212-87015234 ACAGACTGTAAATGAGTAACAGG - Intronic
978120369 4:105072001-105072023 AGGGACAGAATATGAACAAGAGG + Intergenic
979263036 4:118670048-118670070 AGGGAGTGTATGTGATTAAAGGG + Intergenic
983502324 4:168513274-168513296 AGAGCCTGTGTAGGAATAACGGG - Intronic
983835508 4:172378800-172378822 AGAGACTGTACATTAAAAACTGG + Intronic
990279645 5:54236334-54236356 AGGTACTTTAAGTGAATAACTGG + Intronic
990403045 5:55459134-55459156 AGTGACTATATATTAATATCAGG + Intronic
991299514 5:65115417-65115439 AGTGGCTTTATATGAATAAATGG + Intergenic
992137796 5:73765215-73765237 AGGGACTGTCTATAAATATCTGG - Intronic
993379524 5:87190503-87190525 ATAGACTGGATATGAATACCAGG + Intergenic
995259931 5:110091722-110091744 AGGAACTGGATATGAAAGACAGG - Intergenic
995888091 5:116918600-116918622 AGGTGTTGTGTATGAATAACTGG - Intergenic
999490071 5:152041165-152041187 ACGGAATGTATATGAATAAATGG + Intergenic
999582165 5:153050880-153050902 AGGGTCTGTATAATAAGAACAGG + Intergenic
1000841341 5:166222409-166222431 AGTGACTGGATATGAAAAAAGGG - Intergenic
1002737736 5:181408678-181408700 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1008292452 6:49733940-49733962 GGGGACTGTATTTAAAAAACAGG - Intronic
1010899218 6:81405013-81405035 AGGGACTGTATCAGAATCTCTGG - Intergenic
1011600164 6:89052520-89052542 TGGGACTGTTTCTGAATAAGAGG - Intergenic
1012139841 6:95612650-95612672 AGTGACTGTATTCTAATAACAGG - Intergenic
1013775678 6:113676133-113676155 AGGCACTGTCTGTGAAGAACGGG + Intergenic
1017141608 6:151196075-151196097 AGAAACTGTATATAATTAACAGG - Intergenic
1019242834 6:170684235-170684257 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1021901996 7:25294834-25294856 AGGGACTGTACATAAACAAATGG - Intergenic
1022129636 7:27393319-27393341 AGTGAATGTATGTGACTAACAGG - Intergenic
1023159642 7:37284809-37284831 AGAGACAATAAATGAATAACTGG - Intronic
1025718558 7:63987479-63987501 AGGGACTGTATATCACAAACAGG + Intergenic
1025754674 7:64326308-64326330 AGGGACTGTGTATTAAAAATAGG - Intronic
1028447860 7:90945400-90945422 AGGGACTGTTTATGAAACTCTGG + Intronic
1030934555 7:115569058-115569080 ATTGAATGTATATGAATAAATGG - Intergenic
1030952966 7:115815196-115815218 AGGGACTGAATATTAATACATGG - Intergenic
1032578943 7:133085673-133085695 AGGGATTGTATAGGCATGACTGG - Intergenic
1033474564 7:141678873-141678895 AGGGACTGTTATTGAATAAAGGG - Intronic
1034218966 7:149429941-149429963 AGGGCCTGTCTAGGAAAAACAGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035505286 8:123920-123942 AGGGAGTGTATGTGATTAAAGGG - Intergenic
1042518275 8:69682802-69682824 AAGGAACGTATATTAATAACTGG - Intronic
1043058428 8:75469399-75469421 AGGGACAGTATATGAATCTGAGG + Intronic
1046109799 8:109709020-109709042 AGAGAGTGTATATGCACAACAGG + Intergenic
1046537076 8:115529112-115529134 AGGAAATGTACATGAAAAACTGG + Intronic
1051428211 9:16955755-16955777 AGGGAATATAAATGAATAAAAGG - Intergenic
1052150862 9:25113636-25113658 AGGCACTGTATATGCAGAAGCGG + Intergenic
1054941636 9:70749123-70749145 TGGGACTGTATATTAGTAATGGG - Intronic
1055725489 9:79223511-79223533 AGTGGCTATATACGAATAACAGG + Intergenic
1057217883 9:93239447-93239469 AGGGGCTGTATTTGCATAATGGG + Intronic
1057479234 9:95431204-95431226 AGAGATGGTATATGAATAAGAGG + Intergenic
1059785608 9:117579395-117579417 AGGTACTGTCTATGAAGAACAGG + Intergenic
1203603025 Un_KI270748v1:33459-33481 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1187744002 X:22388353-22388375 AGGGACTGTATATTAAAATTAGG + Intergenic
1187765794 X:22640379-22640401 TGGGGCTGTGTATGAATACCTGG - Intergenic
1194485512 X:94481011-94481033 AGGGACTTTATTTGTCTAACAGG + Intergenic
1196775801 X:119335846-119335868 TAGGTTTGTATATGAATAACTGG - Intergenic
1197296485 X:124724971-124724993 ACGTGCTGTATATGAAGAACAGG + Intronic
1199411443 X:147528525-147528547 AGAGAATGAATATGAATATCTGG - Intergenic
1200620901 Y:5445969-5445991 AGAGAATGTATATTAATACCTGG - Intronic
1202385098 Y:24318517-24318539 AGGGAGTGTATGTGATTAAAGGG + Intergenic
1202485687 Y:25351611-25351633 AGGGAGTGTATGTGATTAAAGGG - Intergenic