ID: 1152139046

View in Genome Browser
Species Human (GRCh38)
Location 17:78525687-78525709
Sequence CACGCAGGGACTGCCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152139046 Original CRISPR CACGCAGGGACTGCCTGCTC TGG Intronic
900147678 1:1165539-1165561 CACCCAGGGCCAGCCTTCTCAGG - Intergenic
900515923 1:3082228-3082250 CACACAGGGCCTGACTGCACAGG - Intronic
900586322 1:3433883-3433905 CACGCAGGGACAGGGTTCTCCGG - Exonic
902313899 1:15603314-15603336 CACTCACGGACTCCCTGCTTTGG - Intergenic
903446717 1:23427027-23427049 CCGGCAGGCACTGCATGCTCAGG - Intergenic
903655710 1:24947795-24947817 CACTCAGGCCCTGCCAGCTCCGG - Intronic
906654048 1:47534669-47534691 CAGGCAGGGAGGGCCTGCTAGGG - Intergenic
907424564 1:54371455-54371477 CACATAGGGAGTGCCTGCTGGGG + Intronic
908097912 1:60759503-60759525 GAAGCAGGGACTTCCTGCTGTGG + Intergenic
910771856 1:90839144-90839166 GAGGCAGTGACTGCCTGCTTAGG - Intergenic
911219842 1:95234562-95234584 CACGCAGGGGCCCCCGGCTCCGG - Intronic
916496760 1:165354468-165354490 CGCCCGGGTACTGCCTGCTCTGG + Intronic
922213108 1:223500356-223500378 CAGCCAGGGACCGCCTCCTCTGG - Intergenic
922724170 1:227914826-227914848 CAGGCAGGGGCTGCCTCCTAAGG + Intergenic
924946705 1:248851345-248851367 CAAGCAGGGAGTGCAGGCTCAGG - Intronic
1063046584 10:2398621-2398643 CCAGCAAGGACTGCCTGTTCTGG + Intergenic
1065430105 10:25645234-25645256 CACGAAGGCTCTGCCTGATCTGG - Intergenic
1069743525 10:70700397-70700419 CACCCAGGGACTGTCAGCCCAGG - Intronic
1070991067 10:80732616-80732638 CACGGAGGGACTGGCTGTTGTGG + Intergenic
1074066823 10:110022955-110022977 CACCCAGGGCCTGCATGATCTGG - Intronic
1076647402 10:131962695-131962717 CTGGCAGGGGCTGCCTGCACTGG + Intergenic
1076781222 10:132725665-132725687 CAGGCAGGGAGTGCCAGCCCGGG - Intronic
1078667882 11:13341184-13341206 CACGCCTGGCCAGCCTGCTCTGG + Intronic
1083726174 11:64629684-64629706 CAAGCAGGGACTGAGTGCCCCGG + Intronic
1084942062 11:72618214-72618236 CATCCAGGCACTGCCTGCTCTGG + Intronic
1087233863 11:95696695-95696717 CCAGCAAGGCCTGCCTGCTCAGG + Intergenic
1088432368 11:109772976-109772998 CATTCAGGCAGTGCCTGCTCAGG - Intergenic
1088916604 11:114232543-114232565 CTCTCAGGGACTGCCCGTTCTGG - Intronic
1090521587 11:127485587-127485609 CACGCTGGGACTTCCAGCTAAGG + Intergenic
1091650342 12:2304589-2304611 GAGGCAGGGGCTGCCTGCCCTGG - Intronic
1093646820 12:21595526-21595548 CAGGCAGGAATGGCCTGCTCAGG - Intronic
1096781243 12:53993447-53993469 CAGGCAGGGACTGGGTGCTCAGG + Intronic
1096850204 12:54430641-54430663 CACACAGGGACTCCCTGGGCTGG + Intergenic
1108206427 13:48094880-48094902 AACGCAGGGCCGGCCGGCTCCGG + Intronic
1109136043 13:58652614-58652636 CACTCTGGGACTGTCTGCACAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118453874 14:65928218-65928240 CAGGCAAGGACTCCGTGCTCTGG - Intergenic
1122164755 14:99813933-99813955 CACGCAGGCACAGTGTGCTCCGG - Intronic
1125761972 15:42103041-42103063 CACTCAGGTGCTGCCTCCTCAGG - Intergenic
1125836829 15:42759315-42759337 CACTCAGGGACAGCTGGCTCAGG + Intronic
1127987270 15:64083524-64083546 CAGGCTAGGACTACCTGCTCTGG + Intronic
1132909852 16:2303862-2303884 CACGCAGGTGCTGCATGCTGGGG + Intronic
1137803633 16:51283766-51283788 CATGCTGGGACTGCCTGCTGTGG + Intergenic
1142129428 16:88425949-88425971 TGCCCAGGGACTGCCTGCACCGG - Intergenic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1142985302 17:3691590-3691612 CTGGCAGGGACTGCCTGGTTCGG - Intronic
1143015633 17:3889866-3889888 GCAGCAGGGTCTGCCTGCTCTGG - Intronic
1145877793 17:28332900-28332922 CATGCAGGGTCTTCCTGGTCTGG - Intronic
1146891120 17:36507059-36507081 CAGGCAGGGGCTGCCTGCCAGGG + Exonic
1147989031 17:44322266-44322288 CATGGAGGTACTGCCTTCTCCGG + Intronic
1148328525 17:46798590-46798612 CACACAGTGACTGCCAGCCCTGG + Intronic
1149238981 17:54626335-54626357 CAAGCAGGAAATGCCTGCTTGGG + Intergenic
1152139046 17:78525687-78525709 CACGCAGGGACTGCCTGCTCTGG + Intronic
1152225399 17:79090443-79090465 CTAGCAGCGCCTGCCTGCTCAGG + Intronic
1161738863 19:6008070-6008092 CACGCAGGAGCTGCCTGCCTGGG + Intronic
1163278769 19:16302308-16302330 CACTCAGGGACAGACTTCTCTGG + Intergenic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1165388122 19:35523620-35523642 CACAAGGGGACTGGCTGCTCTGG + Intronic
925345682 2:3170633-3170655 CACGCAGGGACCCCCTGCCACGG + Intergenic
925345765 2:3170940-3170962 CACGCAGGGACCCCCTGCCACGG + Intergenic
926085398 2:10016642-10016664 CATGCTTGGAGTGCCTGCTCTGG - Intergenic
926446254 2:12946394-12946416 CACGCACAGACTGGATGCTCTGG + Intergenic
927096927 2:19754481-19754503 CACCCAGGAACTGCCCACTCTGG + Intergenic
929860729 2:45675243-45675265 CACGCTGGGTCTTCCTGGTCTGG - Intronic
930159429 2:48138987-48139009 CACTCAATGACTGCCTGCTATGG - Intergenic
934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG + Intergenic
934765655 2:96878705-96878727 CAGGCTGGGAGTGCCTGCTAGGG - Intronic
934840502 2:97621337-97621359 CTCCCAGGGACTGCCGGCACAGG - Intergenic
937127092 2:119481887-119481909 CATCCAGGGCCTGCCAGCTCTGG + Intronic
937932783 2:127219426-127219448 CAGGCAGGGATTGCCTGGTTGGG - Intronic
941366452 2:164617268-164617290 CAGGCGGGGACTCTCTGCTCAGG + Intronic
946102209 2:217335299-217335321 CAGGCAGGGACTGCCTCATTGGG - Intronic
948461195 2:238130748-238130770 CACTCAGGCACTGCCTGTGCTGG - Exonic
1169073248 20:2746514-2746536 CAAGGAGGGGCTGCCTGCTGGGG + Intronic
1172851971 20:37972951-37972973 CACACAGGGAAGGCCCGCTCTGG - Intergenic
1174596545 20:51688708-51688730 CGCGCTGGGACTGCCAGCACTGG - Intronic
1175237423 20:57524705-57524727 CACGAGGGGAATGCCTGCTCGGG - Intronic
1175284521 20:57829066-57829088 CCTGCAAGGACTGCCTCCTCCGG - Intergenic
1175511100 20:59526538-59526560 CACGGAGGGTCTGCCTGCTGAGG + Intergenic
1175862962 20:62159934-62159956 GAAGCAGGGACTGCATGTTCTGG - Exonic
1176195024 20:63832735-63832757 CTCGGTGGCACTGCCTGCTCTGG + Intergenic
1177174524 21:17689651-17689673 CAGGCAGGAACTGGCTGCTTAGG + Intergenic
1178074305 21:29000969-29000991 CAAGCAGTGACAACCTGCTCTGG + Intergenic
1180187267 21:46145892-46145914 CGCGCAGGGACTTGCTGCCCAGG + Exonic
1181171224 22:21011368-21011390 CAAGCAGGTAATGCCTGCGCAGG - Intronic
1181967862 22:26669147-26669169 AACGCTGGGACTGTCTCCTCTGG - Intergenic
1184112348 22:42402663-42402685 GCCGCAGGGAGCGCCTGCTCTGG + Intronic
1184118084 22:42433503-42433525 CACCCTGCTACTGCCTGCTCAGG + Intergenic
1184521605 22:44997821-44997843 CACCCAGGGGCGGCCTCCTCAGG + Intronic
1184669388 22:46004830-46004852 CATGCAGGTGCTGCCTGCTTGGG - Intergenic
1185095184 22:48802566-48802588 CACGCAGTGACTGCCCGATGGGG - Intronic
1185312767 22:50165804-50165826 CACGCTGGGACTGCAGGCTTGGG - Intergenic
949414663 3:3800956-3800978 CAGGCAGGGACTCCCTGGGCGGG - Intronic
949819715 3:8103116-8103138 CAGGGAGGGAATGCCTGCTGGGG + Intergenic
950259583 3:11534577-11534599 CAGGCAGGGACTGCATACTGCGG + Intronic
950653983 3:14425354-14425376 CCCGCAGGAGCTGCCTGCACTGG + Intronic
951162429 3:19441044-19441066 GGAGGAGGGACTGCCTGCTCTGG + Intronic
952970836 3:38649424-38649446 CACGCAGGGACTGGAGGCTTCGG + Intronic
953577254 3:44122887-44122909 CACCCAGGGACTGCCAGACCAGG - Intergenic
961318586 3:126057086-126057108 CACAGAGGGACTGCCTCCTCAGG + Intronic
963122666 3:141789347-141789369 CAGGCAGGTACTCCCTGCACGGG + Intronic
970041873 4:11807160-11807182 CACGCAGGGACCGCCTGCCTTGG + Intergenic
978766705 4:112412112-112412134 CACGCAGGGCCCGGGTGCTCCGG - Intronic
984873301 4:184346048-184346070 CAAGCAAGGACTCCCTTCTCAGG + Intergenic
985223943 4:187738684-187738706 CAGGTAGGGCCTGCCTGGTCTGG + Intergenic
986174914 5:5343784-5343806 CATGCAGTGGCTGCCTTCTCAGG + Intergenic
986452310 5:7878842-7878864 CATTCAAAGACTGCCTGCTCTGG - Intronic
987003295 5:13682857-13682879 CTAGCAGGGACTGCCTGCCACGG + Intergenic
989099660 5:37812017-37812039 CACGCAGGGACGGCGTGCATCGG + Intergenic
994635395 5:102339815-102339837 CAAGCAGGGACCTCCAGCTCCGG - Intergenic
997622683 5:135308911-135308933 AATGCAGGGACTGCCTTCTCAGG + Intronic
999067927 5:148711484-148711506 CATTCAGGGCCTGCATGCTCTGG - Intergenic
999188505 5:149730414-149730436 CACGCAGGTACGGCCGGCTGGGG + Exonic
1000837406 5:166172888-166172910 CATGCAGTGACTGCCTCCTTTGG - Intergenic
1001964289 5:175899724-175899746 GACCCAGGGACTGCCGGCTCAGG + Intergenic
1002195885 5:177501091-177501113 TACGCAGGGGCTGCCTGTGCTGG - Intergenic
1002278158 5:178116208-178116230 AGCCCAGGGATTGCCTGCTCCGG - Intronic
1002292025 5:178206483-178206505 CACGCTGGGACTGCTTGGGCAGG + Intronic
1002351137 5:178584620-178584642 GAAGGAGGGACAGCCTGCTCTGG + Intronic
1002445205 5:179286429-179286451 CACGGTGGGTCTGTCTGCTCAGG + Intronic
1003180407 6:3786168-3786190 TACGCTGGGTCAGCCTGCTCAGG - Intergenic
1003450789 6:6229956-6229978 CAGGCAGGGATGGCCTGCTAGGG - Intronic
1003537733 6:6990293-6990315 CATGCAGTGACTACATGCTCAGG + Intergenic
1004421341 6:15472798-15472820 CAGGAAGTGAGTGCCTGCTCAGG - Intronic
1005840564 6:29742371-29742393 CAGGTAGGAGCTGCCTGCTCAGG - Intergenic
1010617500 6:78030491-78030513 CACTCAGTGTCTGGCTGCTCTGG + Intergenic
1011600438 6:89055122-89055144 CACGCAGGGGCTGAGTGCTGTGG - Intergenic
1015052311 6:128856764-128856786 GACCCAGGTACTGCCTTCTCCGG + Intergenic
1016398508 6:143652783-143652805 CACACCTGGACCGCCTGCTCTGG + Intronic
1017324794 6:153131715-153131737 CACGCAGGGAATGCTTCCTCCGG - Intergenic
1018850115 6:167581612-167581634 CATGGAGAGACTGTCTGCTCAGG + Intergenic
1022100455 7:27166269-27166291 CAGGCAGGGACCGGCCGCTCAGG + Intronic
1023889761 7:44383771-44383793 CAGGCAGGGTGTGCCAGCTCTGG + Exonic
1025812194 7:64882401-64882423 CAGGCAGAGACGGCCTGGTCAGG - Intronic
1026944253 7:74306133-74306155 CCCGCAGGTGCTGCCTGCCCAGG + Intronic
1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG + Exonic
1034467321 7:151237750-151237772 CTCGCAGGGTCAGCCTGCTGCGG + Exonic
1035237458 7:157508179-157508201 ACCGCAGGGACTGCCTGGGCGGG + Intergenic
1035381746 7:158445150-158445172 CACCCAGGGCCTGCCCCCTCTGG - Intronic
1035689970 8:1553610-1553632 CACGCAGGGAGGGAATGCTCAGG - Intronic
1039253045 8:35687599-35687621 CACCAAGGGACTGCCTGCCTGGG + Intronic
1043132828 8:76482902-76482924 GAAGCACGGACTGTCTGCTCTGG + Intergenic
1046187374 8:110739531-110739553 CATGGAGGGTCTGCCAGCTCAGG + Intergenic
1049021699 8:139961554-139961576 CAGGCAGGAACTGCCTTCCCAGG + Intronic
1049037374 8:140087014-140087036 CCTGCAAGCACTGCCTGCTCGGG + Intronic
1049322079 8:142001926-142001948 CCAGCAGGGCCTGCCTGCTGAGG - Intergenic
1049499760 8:142955600-142955622 CAGGTAGGGACTTCCTCCTCAGG - Intergenic
1052741388 9:32395979-32396001 GAGGCAGGGGCTGCCTGGTCAGG + Intronic
1054816081 9:69476861-69476883 CTAGCAGGGCCTGCCTGCACAGG - Intronic
1059345144 9:113623269-113623291 CACACCCGGACTGTCTGCTCAGG - Intergenic
1060358426 9:122931767-122931789 CTCGCAGGGACCCGCTGCTCGGG + Intergenic
1062573350 9:137195468-137195490 CACCCAGGATCTGCCTGCACAGG + Intronic
1062578029 9:137217622-137217644 CCAGCAAGGCCTGCCTGCTCTGG - Intergenic
1185469642 X:374687-374709 CACGCAGGACCTTCCTGATCGGG - Intronic
1194106002 X:89767956-89767978 CACGGAGGGACTTTCGGCTCGGG + Intergenic
1200457958 Y:3415815-3415837 CACGGAGGGACTTTCGGCTCGGG + Intergenic
1201424476 Y:13833281-13833303 CACAGAGGGACTGCCTGGTGAGG + Intergenic
1202043636 Y:20714180-20714202 CAGGCAGGAATTGCCTGCTAGGG - Intergenic