ID: 1152139172

View in Genome Browser
Species Human (GRCh38)
Location 17:78526213-78526235
Sequence CACCACATCGGGCAGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152139172_1152139183 9 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139183 17:78526245-78526267 AGGCAGGAGGCAGGGAGAGATGG 0: 1
1: 4
2: 122
3: 1664
4: 8236
1152139172_1152139184 13 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139184 17:78526249-78526271 AGGAGGCAGGGAGAGATGGCAGG 0: 1
1: 2
2: 15
3: 356
4: 4448
1152139172_1152139179 -7 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139179 17:78526229-78526251 TGTGGTGGGTCAGGAGAGGCAGG 0: 1
1: 0
2: 5
3: 36
4: 531
1152139172_1152139185 30 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139185 17:78526266-78526288 GGCAGGTGAGTATTAAGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152139172_1152139181 0 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139181 17:78526236-78526258 GGTCAGGAGAGGCAGGAGGCAGG 0: 1
1: 0
2: 10
3: 122
4: 1022
1152139172_1152139182 1 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139182 17:78526237-78526259 GTCAGGAGAGGCAGGAGGCAGGG 0: 1
1: 0
2: 9
3: 133
4: 978
1152139172_1152139180 -4 Left 1152139172 17:78526213-78526235 CCTGGCTGCTGCCCGATGTGGTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1152139180 17:78526232-78526254 GGTGGGTCAGGAGAGGCAGGAGG 0: 1
1: 0
2: 9
3: 118
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152139172 Original CRISPR CACCACATCGGGCAGCAGCC AGG (reversed) Intronic
900001558 1:17500-17522 CAGCACATAGGCCAGGAGCCAGG - Intergenic
900021278 1:188024-188046 CAGCACATAGGCCAGGAGCCAGG - Intergenic
900156204 1:1204293-1204315 CAGCACGGAGGGCAGCAGCCGGG - Intronic
900158742 1:1213609-1213631 CAGCACAGGGGGCGGCAGCCTGG - Intronic
900210412 1:1452946-1452968 CACCACAGCAGGCCGGAGCCTGG - Intronic
900335613 1:2161526-2161548 CACCACATCAGGAAACAGCAGGG - Intronic
900338758 1:2177811-2177833 CAACACAGCCCGCAGCAGCCAGG - Intronic
900476361 1:2878203-2878225 CCCCACAACAGCCAGCAGCCAGG - Intergenic
900662242 1:3790579-3790601 CACAGCAGCGGGAAGCAGCCAGG + Intronic
901245637 1:7728349-7728371 CACCTCCACGGGCAGCAGGCAGG + Intronic
904611251 1:31727465-31727487 CTCTGCACCGGGCAGCAGCCTGG - Exonic
905396302 1:37668871-37668893 CAACGCTTCGGGAAGCAGCCGGG - Intergenic
905906984 1:41625423-41625445 TACCGAATCAGGCAGCAGCCTGG + Intronic
907051433 1:51331913-51331935 TACCAGATCGGGGAGCAGCATGG + Intronic
908901586 1:68962594-68962616 CAACACATTGTGCGGCAGCCAGG - Intergenic
912659053 1:111512592-111512614 CACCACCTTGGGCAGCTACCAGG + Intronic
915064150 1:153210753-153210775 CCTCACCTCGGGCAGCAGCAAGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
916169262 1:161988457-161988479 CACCCCAAGGGGCAGCAGTCGGG - Intronic
918445414 1:184612435-184612457 CACCACACCCGGCCTCAGCCAGG - Intronic
922796876 1:228344583-228344605 CTCAACATGAGGCAGCAGCCAGG + Intronic
1062930018 10:1346717-1346739 CACTACCTGGGGCAGCAGGCCGG + Intronic
1062955676 10:1538817-1538839 CACTGCATGCGGCAGCAGCCAGG - Intronic
1064002888 10:11678130-11678152 CACAAAACCGGGCAGCAGGCAGG - Intergenic
1066051056 10:31636095-31636117 CACCCCACCGCTCAGCAGCCAGG + Intergenic
1066381560 10:34906217-34906239 CACCACATTGGGTAGAAGCAGGG + Intergenic
1067205673 10:44209982-44210004 CTGCACAGCGGGCAGCAGGCTGG + Intergenic
1069490660 10:68857789-68857811 CACCACCTCAGGCTCCAGCCTGG - Intronic
1070022892 10:72604315-72604337 CACAACATTGCGCTGCAGCCTGG - Intronic
1070900318 10:80022706-80022728 CACCCCATGGGGGAGAAGCCTGG - Intergenic
1071193562 10:83130350-83130372 CACCACACCTGGCAGTAGCAAGG + Intergenic
1073137412 10:101227628-101227650 GACCAAATCGCGCAGCAGCTGGG - Exonic
1075414095 10:122249697-122249719 CAGCACAGAGAGCAGCAGCCCGG - Intronic
1076646214 10:131956684-131956706 AAACACAGCGGGCAGCAGCTTGG - Intronic
1077160171 11:1109122-1109144 CCCCACATCAGGCACCAGCCTGG - Intergenic
1080278635 11:30531292-30531314 CAGCACTACGGGCAGCAGCCAGG + Intronic
1080576739 11:33606774-33606796 CCCCACCTCGGACAGGAGCCAGG + Exonic
1080589592 11:33710141-33710163 CTCCATTTCTGGCAGCAGCCTGG - Exonic
1083264068 11:61538046-61538068 CACCACCTCGTCCAGCAGCCGGG + Intronic
1083643438 11:64158152-64158174 CACCACACTGTGCAGAAGCCAGG - Intronic
1086431694 11:86742570-86742592 GCCCACAGCGGGCAGGAGCCAGG + Intergenic
1089003134 11:115068650-115068672 CCTCACATCTGGCACCAGCCAGG - Intergenic
1090377347 11:126300491-126300513 CACCACGTGGGGCATGAGCCAGG + Intronic
1090657950 11:128860108-128860130 CCCCAGACCGGGCAGGAGCCAGG + Intronic
1091703602 12:2679542-2679564 CAACAAGGCGGGCAGCAGCCAGG + Exonic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094607596 12:31962172-31962194 CACCCCATCGTACTGCAGCCTGG + Intronic
1096560764 12:52434229-52434251 CACCACCTCGGCCATCACCCCGG - Exonic
1102581959 12:113895001-113895023 AACCACTTAGGCCAGCAGCCAGG + Intronic
1105746245 13:23379373-23379395 CACCTCATGGCACAGCAGCCAGG + Intronic
1106415698 13:29544013-29544035 CACAGCATCGGGCCTCAGCCAGG + Intronic
1114512763 14:23276235-23276257 CCCCACATCTGGAACCAGCCTGG - Exonic
1118798464 14:69167167-69167189 CACCACATTGGTCACCAGTCTGG - Intergenic
1121449894 14:94000591-94000613 AGCCACATCGCCCAGCAGCCCGG - Intergenic
1121633675 14:95439503-95439525 CTCCACACTGGGCAGCACCCTGG + Intronic
1122407315 14:101508290-101508312 CCCCTCTTCTGGCAGCAGCCTGG + Intergenic
1122598301 14:102908416-102908438 CAACACAGTGGGCAGCAGCCTGG + Exonic
1122694520 14:103546285-103546307 CACCACACAGGGCAGCTGGCGGG - Intergenic
1122898835 14:104773753-104773775 CCCCACAGCAGGCAGCTGCCTGG + Intronic
1129389705 15:75214456-75214478 CACCAGCTGGGGCAGCAGGCTGG - Intergenic
1132451951 15:101973436-101973458 CAGCACATAGGCCAGGAGCCAGG + Intergenic
1139358067 16:66379361-66379383 CGCCACATCGGGCGCCTGCCTGG + Exonic
1141063101 16:80893071-80893093 TACCACACCAGGCAGCAGGCTGG + Intergenic
1141703713 16:85653659-85653681 CACCAGAACAGGCAGCAGCTGGG - Intronic
1141917652 16:87110893-87110915 CAGATCATCAGGCAGCAGCCAGG - Intronic
1142007611 16:87697167-87697189 CACCCCAGTGGGCAGTAGCCTGG + Exonic
1142541173 17:660653-660675 CACCACACCCAGCAGCACCCAGG - Intronic
1142541186 17:660700-660722 CACCACACCCAGCAGCACCCAGG - Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1144048881 17:11480461-11480483 CACCACACCGGACAGCTGCCAGG + Intronic
1146005771 17:29159711-29159733 CCCCACTCCTGGCAGCAGCCAGG + Intronic
1146487680 17:33257190-33257212 CACAACCGTGGGCAGCAGCCAGG + Intronic
1149602666 17:57903331-57903353 AGCCACAATGGGCAGCAGCCAGG + Intronic
1152139172 17:78526213-78526235 CACCACATCGGGCAGCAGCCAGG - Intronic
1152203645 17:78961763-78961785 CATCCCACTGGGCAGCAGCCTGG - Intergenic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1162739271 19:12764910-12764932 CACCTCTTCCGCCAGCAGCCCGG - Exonic
1163040256 19:14596914-14596936 CACCTCTTCTGGCAGCAGCCAGG - Exonic
1163478793 19:17542436-17542458 CACCACATGTGGCTGCTGCCTGG - Intronic
1163602701 19:18258355-18258377 CACCACTTCGGGCTGAGGCCTGG + Intronic
1163641484 19:18464939-18464961 CACCACAGCCGGCAACAGGCAGG - Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164645559 19:29856583-29856605 CACCAGCTCTGGCAGGAGCCTGG - Intergenic
1165159142 19:33805669-33805691 CACCACATCCTTCAGCAGGCAGG - Intronic
1165381997 19:35488295-35488317 CAGCCCATTGGGCAGCATCCAGG + Intronic
1166355296 19:42223843-42223865 CACCACCCCGGCCAACAGCCCGG - Intronic
1167553126 19:50174793-50174815 CACCACAGCCGGCCCCAGCCAGG - Intergenic
929880974 2:45837119-45837141 CAGCACATCAGCCAGCAGCCTGG + Intronic
930602207 2:53456018-53456040 CACCACACCTGGCAGCAGCCTGG + Intergenic
935215537 2:100972590-100972612 CACCACATGGCACAGCAGCCGGG - Intronic
936568167 2:113595913-113595935 CAGCACATGGGCCAGGAGCCAGG + Intergenic
938597432 2:132802167-132802189 CACCAAGACGGGGAGCAGCCAGG - Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
945988341 2:216372125-216372147 GACAACACCTGGCAGCAGCCTGG - Intergenic
947795052 2:232889352-232889374 CTCCACATCAGGCAGCATGCTGG - Intronic
1171083904 20:22218151-22218173 CACCACTATGGCCAGCAGCCAGG + Intergenic
1172273647 20:33668207-33668229 GAACACATCGTACAGCAGCCTGG - Exonic
1172843282 20:37914909-37914931 CCCCACCTCGGGCCCCAGCCTGG - Intronic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1174028268 20:47597955-47597977 CACCACGCCCGGCAGAAGCCTGG - Intronic
1176214451 20:63941631-63941653 CACCACCTCGGGGAGGAGCCAGG - Intronic
1176306227 21:5124672-5124694 GACCACATTGGACAGCAGACAGG + Intronic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1178531569 21:33380754-33380776 CAACGCCTGGGGCAGCAGCCAGG + Intergenic
1179850831 21:44137358-44137380 GACCACATTGGACAGCAGACAGG - Intronic
1180241623 21:46511069-46511091 CACCACAGCGGTGAACAGCCAGG - Intronic
1183718088 22:39545961-39545983 CAGCACCACGGACAGCAGCCCGG + Intergenic
1185292947 22:50036215-50036237 GACCCCCTCCGGCAGCAGCCGGG + Intronic
953810645 3:46109535-46109557 CACCACACCAGCCAGCACCCTGG - Intergenic
953927531 3:46989976-46989998 CACCAGATCCTCCAGCAGCCAGG - Intronic
954217404 3:49132286-49132308 CACCACAGCGGCGGGCAGCCTGG - Exonic
954318056 3:49811978-49812000 CACCACATGGGGCTGGAGCAGGG + Exonic
955059180 3:55481905-55481927 CCCCACACCTGGCAGCTGCCAGG + Intronic
955785113 3:62529421-62529443 CAGCACCTTGGACAGCAGCCAGG + Intronic
960996552 3:123344016-123344038 CACCACCCCGGGGCGCAGCCAGG - Intronic
962344631 3:134610226-134610248 CAGCACCTGGGGCAGCGGCCTGG - Exonic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
968189809 3:196659719-196659741 AACCACACCGGTCAGCAGCGAGG - Intronic
968481088 4:833410-833432 CACCACATGAGGCCGCAGCAAGG - Intergenic
968669606 4:1842010-1842032 CACCACGTCGGACAGGAGCATGG + Intronic
969032997 4:4228175-4228197 CATCCCACCGTGCAGCAGCCCGG + Intergenic
969414710 4:7050811-7050833 CACAACATCGGGAAGCGGCTAGG + Intronic
969572790 4:8019870-8019892 CAGGAGATGGGGCAGCAGCCAGG + Intronic
969716807 4:8871807-8871829 CAGCTGATCGGGCAGCCGCCTGG + Exonic
970604678 4:17667956-17667978 CAGCTCCTGGGGCAGCAGCCAGG + Intronic
971730274 4:30370312-30370334 CACCACTTCTGGGAGGAGCCCGG + Intergenic
973074093 4:45901029-45901051 CACCACAACTGGCACCAGGCTGG - Intergenic
974439465 4:61898170-61898192 CACCACGTAGGGCAGAAGGCAGG + Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
982232607 4:153222904-153222926 CACGACATCAGGCAGCGGGCAGG - Intronic
982358065 4:154490903-154490925 CACCACAGCGCCCAGCAGCGTGG + Intronic
982657820 4:158171055-158171077 CACCACATTGGGCTGCAGAGTGG + Exonic
985663922 5:1172092-1172114 CACCCCATCCCCCAGCAGCCTGG + Intergenic
985702312 5:1380950-1380972 CGCCACATCCGCCAGCACCCTGG + Intergenic
987312503 5:16694335-16694357 CAACCCATCGGGCCACAGCCAGG + Intronic
997856775 5:137379756-137379778 CACCACACCAGTCACCAGCCAGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1003280411 6:4686241-4686263 CTCCACAAAGGGCAGGAGCCTGG + Intergenic
1007204111 6:40134688-40134710 CACCACCTCTGGCAGCAGCCTGG - Intergenic
1008516454 6:52323776-52323798 CACCACATAGAGCAGCAGAATGG - Intergenic
1011651347 6:89509155-89509177 CAAGACATCAGGAAGCAGCCAGG - Intronic
1015315406 6:131810860-131810882 CACCACAATGGGGAGAAGCCAGG - Intronic
1015560536 6:134510648-134510670 CACGACATTGTGCAGCAGCCTGG + Intergenic
1018181096 6:161224353-161224375 CACCACATCTGGCTGCAGTCTGG - Intronic
1019347999 7:539885-539907 CACCACACAGGGCAGCCGCCTGG - Intergenic
1019446696 7:1074945-1074967 CACCACACGGGGCAGCCACCAGG - Intronic
1019496803 7:1344582-1344604 AACCATATCAGGCAGCTGCCAGG + Intergenic
1019596888 7:1862218-1862240 CAGCACACCGAGCAGCACCCCGG + Intronic
1023245457 7:38198624-38198646 CACTACTTATGGCAGCAGCCAGG - Intronic
1023845299 7:44116931-44116953 CACCACATCCACCAGCAGCTGGG + Exonic
1031196919 7:118627331-118627353 CATTACATAGGGCAGCTGCCTGG - Intergenic
1034546179 7:151790950-151790972 CACCACTCCGGGCAGCCGCCTGG - Intronic
1035170966 7:157017334-157017356 CACCACACCTGGGAGCAGCATGG + Intergenic
1035386987 7:158479732-158479754 CACCCCCACAGGCAGCAGCCAGG - Intronic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1048977590 8:139681636-139681658 CAGCACAGCGGGCAGCAAGCTGG + Intronic
1049782710 8:144436117-144436139 CAGCACAACGGGTGGCAGCCTGG - Exonic
1049884366 9:17613-17635 CAGCACATAGGCCAGGAGCCAGG - Intergenic
1056538382 9:87551025-87551047 CCCCACCTTGGCCAGCAGCCGGG + Intronic
1057276107 9:93676746-93676768 CACCAGCACGGCCAGCAGCCAGG + Exonic
1058447500 9:105066805-105066827 CACCACAGGGGGCTCCAGCCTGG + Intergenic
1058979654 9:110157338-110157360 CACCACAACAGGCATAAGCCAGG - Intronic
1062337732 9:136079807-136079829 CACCAGGACAGGCAGCAGCCGGG + Intronic
1062418708 9:136467946-136467968 CACCCCACCGGGCAGCGACCTGG - Intronic
1062680531 9:137776830-137776852 CACCACAACGGGCAGGTACCTGG + Exonic
1062703665 9:137922160-137922182 CACCACACCGCACAGCATCCTGG + Intronic
1189864336 X:45309085-45309107 GACCACATAGGGCTGCAGCATGG - Intergenic
1191117526 X:56867083-56867105 CACCACCCCTGGTAGCAGCCTGG - Intergenic
1200401439 X:156022543-156022565 CAGCACATAGGCCAGGAGCCAGG + Intergenic