ID: 1152145282

View in Genome Browser
Species Human (GRCh38)
Location 17:78564594-78564616
Sequence CTTCCACGTGGAGCCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152145282 Original CRISPR CTTCCACGTGGAGCCCCTGA AGG (reversed) Intronic
903970001 1:27112534-27112556 CTACCACGTGCAGACCCTGGAGG + Intronic
904497950 1:30898038-30898060 CTTCCATGTGGAGGACCTGTGGG + Intronic
908338987 1:63157042-63157064 GTTCCACGTGGAGGCTCTGAGGG + Intergenic
910398016 1:86811126-86811148 CTGCCACTTGGAACCACTGAAGG - Intergenic
910934250 1:92474494-92474516 CTACCTTGTAGAGCCCCTGATGG - Intergenic
912551139 1:110486068-110486090 CTTCCACATGAGACCCCTGAGGG - Intergenic
916755102 1:167761831-167761853 GTTCCAGGTGAAGGCCCTGAAGG + Intronic
924483381 1:244456330-244456352 CTTCAGGGTGGAGCCCCTGGAGG - Intronic
1063125377 10:3132379-3132401 GTCCAACGTGGAGCACCTGACGG + Exonic
1066126219 10:32346199-32346221 CCCCCACGTGGAGCCTCAGACGG - Intronic
1067058243 10:43064688-43064710 CCTCCACCTGGAGGCCCTGGGGG - Intergenic
1070576864 10:77686034-77686056 CTTCCACGGGAAGCACCTGTCGG - Intergenic
1071359061 10:84827622-84827644 CTTTCAAGTGCAGGCCCTGAGGG + Intergenic
1073117093 10:101097337-101097359 CACCCACTTGGACCCCCTGAAGG - Intronic
1075913739 10:126148435-126148457 CTTCCAGCAGGAGCCCCTTAAGG - Intronic
1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG + Exonic
1078086281 11:8234629-8234651 CTTCCCCGTGGCTCCCCTGCTGG + Intronic
1081775220 11:45671692-45671714 CTTCCAGGTGGTTCCCCTGCAGG + Intergenic
1082271143 11:50170447-50170469 CCTGCACGTGAAGCCCCTGTTGG + Intergenic
1083504188 11:63139815-63139837 CTTCCAGGTAGAGCCCTTGGAGG - Intronic
1083635303 11:64117587-64117609 CATCCACGTGAAGGCCCTGACGG + Exonic
1083804766 11:65067159-65067181 CTTCCAAGGGGAGCCTCAGAGGG - Intronic
1084188775 11:67489434-67489456 CTTCCACATGGAGATGCTGAAGG + Exonic
1084412792 11:69013911-69013933 CTTCCCCATTGAGCCCCTGGAGG + Intergenic
1084514327 11:69627955-69627977 ATTCCCCGGGGAGCCACTGAGGG + Intergenic
1084598307 11:70130355-70130377 CTTCCACAAGGAGCCCCCCATGG + Intronic
1084706469 11:70818942-70818964 TTGCCAGGTGGAGCCCCTGGGGG + Intronic
1089660408 11:119981842-119981864 CTTCCACGAGGAGCTCCTTGGGG - Intergenic
1091809101 12:3379996-3380018 CTCTCACCTGTAGCCCCTGATGG - Intergenic
1096244247 12:49975467-49975489 CTTCTGGGTGGGGCCCCTGATGG + Exonic
1096523455 12:52197119-52197141 AAGCCACGGGGAGCCCCTGAAGG - Intergenic
1098629482 12:72708566-72708588 CTTCCACGTATAGGCCCAGATGG + Intergenic
1101320691 12:103670566-103670588 TTTCCACGAGGAGTCCCAGAGGG + Intronic
1102929866 12:116854002-116854024 CTTCCCCTTGGAGCCTCTTAGGG - Intergenic
1104142725 12:126004246-126004268 CCTCCACATGGAGTCCCTAATGG + Intergenic
1105577872 13:21670129-21670151 CTTCCACGTGCGGCCCCGCAGGG + Intergenic
1107328137 13:39267311-39267333 CTTCCTCCTGGAGGCACTGAGGG - Intergenic
1108829959 13:54465089-54465111 GTTCGTCGTGTAGCCCCTGAGGG - Intergenic
1113797525 13:113066991-113067013 CATCTACGAGGAGCCCCTCAAGG - Intronic
1117222706 14:53621563-53621585 CATCCAAGTGGATCCCATGAAGG - Intergenic
1118787131 14:69055224-69055246 CTTCCACCTGGGGCCCCTGCGGG - Exonic
1119261766 14:73241924-73241946 CTCCCACCTGGAGCCACTCAGGG - Intronic
1119856078 14:77901959-77901981 CCTGCACATGGAGCTCCTGAGGG - Intronic
1122172786 14:99890478-99890500 CTTCCACGAGGGGACCCTGGGGG - Intronic
1122621277 14:103058605-103058627 CCTCCAGGTGGAGCCGATGAAGG + Intergenic
1122775182 14:104113851-104113873 CCTCCACCTGCAGCCCCTCATGG - Exonic
1122987171 14:105217854-105217876 GCCTCACGTGGAGCCCCTGATGG - Intronic
1125747742 15:42008637-42008659 CTTCCACCTGGAGCAACAGAAGG + Intronic
1127781402 15:62319759-62319781 TTTCCAGGTAAAGCCCCTGATGG - Intergenic
1131135748 15:89933771-89933793 CTTCTGCTTGGAGCCCCTGAAGG - Intergenic
1135423933 16:22323014-22323036 CCTCCACCTGGAGCCTCTGCCGG - Intronic
1137679151 16:50324060-50324082 CTTCCATGTGGAGCACCAAAGGG - Intronic
1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG + Intergenic
1139487176 16:67264532-67264554 CTCCCAAGAGGAGTCCCTGAGGG - Intronic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1142303936 16:89275155-89275177 CTCCCTGGCGGAGCCCCTGAAGG - Exonic
1142780031 17:2174437-2174459 CTTCCACCTGGAGCCAGTCAGGG - Intronic
1143173245 17:4942334-4942356 CCTCCACAAGGAACCCCTGAAGG - Exonic
1144507932 17:15849239-15849261 CTACCACATGGAGCCGCTGCAGG + Intergenic
1145267340 17:21386180-21386202 GTTCCTCGCGGAGCCTCTGAGGG + Intronic
1147543566 17:41381091-41381113 GTCCCAGGTGGAGTCCCTGAGGG - Exonic
1150600470 17:66646453-66646475 CTTGCACTTGGGGTCCCTGAGGG + Intronic
1152145282 17:78564594-78564616 CTTCCACGTGGAGCCCCTGAAGG - Intronic
1152656895 17:81524021-81524043 CTTCCCCTTGGAGCACCAGACGG + Intergenic
1153560128 18:6363279-6363301 CGTCCAGGGGCAGCCCCTGATGG + Intronic
1156829077 18:41468751-41468773 CCTCCACCTGGAGCCCCAGGAGG - Intergenic
1160699165 19:497840-497862 CCTCCAGGTGAAGCCCCTGCAGG + Exonic
1162988981 19:14290060-14290082 CTTCCAGGTGGAGCCAATGGAGG - Intergenic
1164759671 19:30719596-30719618 CTTCCTCTTGGAGCCCGTGCGGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166259325 19:41626932-41626954 CCTCCACGGGGAGCGGCTGAGGG + Exonic
1166846253 19:45730552-45730574 CATCCAGGTAGAGGCCCTGAAGG - Intronic
1166856654 19:45785716-45785738 CATCCACGAGGTGCCCCTGCTGG - Exonic
1167494220 19:49808580-49808602 CTTCACCGTGGAGCCCTTGGGGG - Exonic
926954761 2:18282296-18282318 CTTCTGAGTGGAGCACCTGAGGG + Intronic
927201474 2:20580785-20580807 CTTCCACCAGCAGCTCCTGAGGG - Intronic
928922744 2:36542375-36542397 TTTCCAAGTAGAGCCCCTGTGGG + Intronic
929595049 2:43170530-43170552 CTGCCACCTGGAGCCCCTCAAGG + Intergenic
930001620 2:46865613-46865635 CTTCCACGTGGTGACTTTGAAGG - Intergenic
932282016 2:70501627-70501649 CTTCCACGTTGTCCCCCAGATGG + Intronic
934165389 2:89289644-89289666 CTCCCTCCTGGAGCCTCTGAAGG - Intergenic
934201885 2:89892818-89892840 CTCCCTCCTGGAGCCTCTGAAGG + Intergenic
934219902 2:90073035-90073057 CTTCCTCTTGGAGACACTGAGGG - Intergenic
934905446 2:98197263-98197285 CTTCCCAGTGGATCACCTGAAGG + Intronic
937463585 2:122110310-122110332 CTTCCCCTTGGAGTCACTGAAGG + Intergenic
938087014 2:128408408-128408430 CTCCCACGTGGGGCCCATGCAGG - Intergenic
939702592 2:145412057-145412079 CTTCCTCCTGGAGCTGCTGATGG - Intergenic
941803574 2:169687781-169687803 CTCCCACGTAGAGTCCCTAATGG - Intronic
946322206 2:218960669-218960691 CTTCCTCGTGGAGCCCGACAAGG + Exonic
948293617 2:236845405-236845427 CTTCTTCCTGGAGCCCCCGAGGG + Intergenic
948513318 2:238487687-238487709 CTTCCTCCCGGAGGCCCTGAGGG - Intergenic
948826653 2:240576354-240576376 CTGCCACTTGAAGCCACTGAAGG - Intronic
949052563 2:241904968-241904990 CTTCCAGGAGGAGGCCCCGAGGG - Intergenic
1168789026 20:563641-563663 CTTCCCCCTAGAGCCACTGAGGG + Intergenic
1171310006 20:24138377-24138399 CTTGCAGGTGGAGCCTGTGAAGG + Intergenic
1172887641 20:38241791-38241813 CCTCCAAGTGGAGCCCCAGGAGG - Exonic
1175069020 20:56316309-56316331 CTTCCAGGTGGAGGGCCTGAAGG - Intergenic
1176110369 20:63408119-63408141 GTTCCACAAGGAACCCCTGAGGG + Intronic
1179487099 21:41717335-41717357 CTTCACCGTCGAGACCCTGATGG - Intergenic
1180177064 21:46096020-46096042 CATCCAGGTGGAAGCCCTGAGGG - Intergenic
949720993 3:6990105-6990127 CATCCACAGGGAGCCCCTGCTGG - Intronic
952092718 3:29909483-29909505 CTTCCAAGTAGAGTTCCTGAAGG + Intronic
953121322 3:40045411-40045433 CTGCCATGTGGAGACCCAGATGG - Intronic
955405566 3:58623597-58623619 ATCCCACCTGGAGCCCCTGTCGG - Intronic
961205889 3:125081240-125081262 ATCCCTCGTGGAGCCTCTGAAGG + Intergenic
961329504 3:126130365-126130387 CTTCCTCCTGGAGACCCTGGTGG - Intronic
965679584 3:171236235-171236257 CTCCCAGGTGTAGCCCCTGATGG - Intronic
969452383 4:7282006-7282028 CTGCCTCGTGGAGCTCCTAAGGG + Intronic
969876773 4:10141316-10141338 CTTCCAGGCTGAGCCCCTGGAGG + Intergenic
971279339 4:25229523-25229545 CTTCAAGGTGGAGCCCTTGGAGG - Intronic
974458260 4:62156222-62156244 CTTCCTTGTGGAGGCTCTGAGGG - Intergenic
974922733 4:68261869-68261891 CTTCAAGGTGGAGCCCTTGGAGG - Intergenic
977687904 4:99870574-99870596 CTCCCAAGTGGAGCCTGTGAGGG + Intergenic
978605706 4:110476723-110476745 CCTGCACGTGAAGCCCCTGTTGG + Exonic
982169205 4:152644897-152644919 ATTCCAAGGGGAGCCCTTGATGG - Intronic
982278233 4:153658664-153658686 CTACAACGTGGAGCCCTTGATGG + Intergenic
982354676 4:154453162-154453184 CATCCAGCTGGAGCTCCTGAAGG + Intronic
982828443 4:160028689-160028711 CTTCAACTTGTAGCCCATGAAGG - Intergenic
983739405 4:171109701-171109723 CTTCCTTCTGGAGACCCTGAAGG - Intergenic
983939442 4:173524999-173525021 CTTCCACGTCTAGGACCTGATGG + Intronic
986081758 5:4401799-4401821 CTTCCATGAGGAGGCCCTGAGGG - Intergenic
991406135 5:66302577-66302599 CTTGCACGTGGCGCTCCTGCTGG - Intergenic
992555219 5:77896502-77896524 CTTCCACTTGGAGGGCCTCAGGG - Intergenic
995839699 5:116431544-116431566 CTGCCACCTCCAGCCCCTGATGG + Intergenic
998434741 5:142097882-142097904 CTTCCACTAAGGGCCCCTGAGGG + Intergenic
999254293 5:150201216-150201238 CTTCCAAGGTGAGCCCCTCAGGG + Exonic
1001673200 5:173491380-173491402 ATTCCTCCTGGAGCCACTGAGGG - Intergenic
1002563821 5:180099271-180099293 CTGCCCTGTGGAGCCCCTGGGGG + Intergenic
1007290123 6:40779463-40779485 CTCTCACGTGAAGCCCCAGAAGG + Intergenic
1012417330 6:99024887-99024909 CTCCCATGGGGGGCCCCTGAGGG + Intergenic
1018801985 6:167230030-167230052 CTTCAGGGTGGAGCCCTTGAAGG - Intergenic
1018890138 6:167977094-167977116 CCTCCGCGTGGAGCCTCTGAGGG - Intergenic
1019324765 7:432642-432664 CTTGTTCATGGAGCCCCTGAAGG - Intergenic
1019612775 7:1945314-1945336 CTTCCACATGGAGCCTGTGCCGG - Intronic
1025022715 7:55492448-55492470 CTCCCAGGTGGGGGCCCTGAGGG + Intronic
1027329747 7:77079325-77079347 CTTCCTCATAGAGCCCATGAGGG - Intergenic
1029786015 7:102792014-102792036 CTTCCTCATAGAGCCCATGAGGG + Intronic
1033414170 7:141147659-141147681 CTCCCACGTGGGGCTCCTTAGGG - Intronic
1035129828 7:156641113-156641135 CCTGCACCTGGGGCCCCTGATGG - Intronic
1038267793 8:26049660-26049682 CTTTCACGTGAAGCCCCTGCTGG + Intergenic
1038439969 8:27564897-27564919 CTTTCTCCTGGAGCCCCTGAAGG + Intergenic
1040560966 8:48523307-48523329 CTTCCCCGTGGTGGCCCTGCAGG + Intergenic
1040602917 8:48902248-48902270 CTTCCTCCTGCAGCCCCGGATGG + Intergenic
1042816416 8:72882315-72882337 ATTCCAAGGGTAGCCCCTGAAGG - Intronic
1043721539 8:83550750-83550772 CTTCCACTTGCAGCCCATGCTGG - Intergenic
1045531325 8:102988021-102988043 CCTCCAGATGAAGCCCCTGAGGG - Intergenic
1047618743 8:126585197-126585219 TTTCCACGAGGAGTCCCTCAAGG + Intergenic
1049333135 8:142065629-142065651 GTTCCACCTGCAGGCCCTGAGGG - Intergenic
1049463015 8:142738855-142738877 CTGCCTCGTTGAGCCCCTGGCGG - Intergenic
1049585265 8:143430077-143430099 CTTCCCCGAGGTGCCCCCGACGG + Exonic
1049799374 8:144510670-144510692 CTTCCACCTGGACACCCTGGGGG + Exonic
1049954559 9:680375-680397 CTTCCCCTTGGAGTCCCTCACGG + Intronic
1050802311 9:9630430-9630452 CTTCTACTTCGAGTCCCTGAAGG + Intronic
1051192966 9:14534239-14534261 CTTCCACCTAGAGCACCTGAGGG - Intergenic
1052963319 9:34319219-34319241 CCACCACGTGGAGCCCCTCGAGG + Intronic
1055389541 9:75805086-75805108 CTTCTACTTTGAGCCCCAGAAGG + Intergenic
1061175943 9:128997154-128997176 CTTCCAGGTGGAGCCCGTGGAGG + Intronic
1061408492 9:130405607-130405629 CCTCCTCTTGGAGCCCCTGTTGG + Intronic
1061899509 9:133665844-133665866 CTTCCAGCCTGAGCCCCTGATGG - Intronic
1061941652 9:133887202-133887224 TTTCCATGGGGAGTCCCTGAGGG - Intronic
1062042816 9:134411947-134411969 TTTCCACGTGGGGTCCCTGCAGG - Intronic
1062070131 9:134550961-134550983 ATTCCACGTGGTGGCCCAGAGGG + Intergenic
1189231055 X:39452798-39452820 CTTCCACATGAACCCCCTGGAGG + Intergenic
1190305172 X:49077852-49077874 CTACAACGTGGAGCCCTTGATGG - Exonic
1192165879 X:68827537-68827559 CTTCCAGGGGCAGCCCTTGAGGG - Intergenic
1199336043 X:146620072-146620094 CTCCCTGGCGGAGCCCCTGAAGG - Intergenic
1201252852 Y:12076970-12076992 CTTCCACTGGGTGCCTCTGAGGG + Intergenic