ID: 1152147980

View in Genome Browser
Species Human (GRCh38)
Location 17:78580693-78580715
Sequence ACCCCAGAGCTCCCAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152147979_1152147980 0 Left 1152147979 17:78580670-78580692 CCGTCACTTCAGTTCTGCATATC No data
Right 1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG No data
1152147978_1152147980 8 Left 1152147978 17:78580662-78580684 CCACTAAACCGTCACTTCAGTTC No data
Right 1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG No data
1152147977_1152147980 26 Left 1152147977 17:78580644-78580666 CCAGGAGCAAAATCAGTGCCACT No data
Right 1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152147980 Original CRISPR ACCCCAGAGCTCCCAGACAC AGG Intergenic
No off target data available for this crispr