ID: 1152153277

View in Genome Browser
Species Human (GRCh38)
Location 17:78616252-78616274
Sequence TCTCACTTGGCGAAGTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152153277_1152153283 22 Left 1152153277 17:78616252-78616274 CCAGACGACTTCGCCAAGTGAGA No data
Right 1152153283 17:78616297-78616319 TTGTCCCTAAGAAGGTCCAGAGG No data
1152153277_1152153281 14 Left 1152153277 17:78616252-78616274 CCAGACGACTTCGCCAAGTGAGA No data
Right 1152153281 17:78616289-78616311 CCTGACCATTGTCCCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152153277 Original CRISPR TCTCACTTGGCGAAGTCGTC TGG (reversed) Intergenic
No off target data available for this crispr