ID: 1152157043

View in Genome Browser
Species Human (GRCh38)
Location 17:78641311-78641333
Sequence CTGGTTGACCAGAGGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152157043_1152157054 21 Left 1152157043 17:78641311-78641333 CCAAGCTCCCTCTGGTCAACCAG No data
Right 1152157054 17:78641355-78641377 CTCCTGCCTCTGACTGCCAATGG No data
1152157043_1152157047 -6 Left 1152157043 17:78641311-78641333 CCAAGCTCCCTCTGGTCAACCAG No data
Right 1152157047 17:78641328-78641350 AACCAGCCAGAGGATGATCCTGG No data
1152157043_1152157056 25 Left 1152157043 17:78641311-78641333 CCAAGCTCCCTCTGGTCAACCAG No data
Right 1152157056 17:78641359-78641381 TGCCTCTGACTGCCAATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152157043 Original CRISPR CTGGTTGACCAGAGGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr