ID: 1152158112

View in Genome Browser
Species Human (GRCh38)
Location 17:78648242-78648264
Sequence CCTCGGCCTTGCTGCAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158112_1152158121 29 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158121 17:78648294-78648316 CTGAGGTCAGTTCAGTTGGAAGG No data
1152158112_1152158120 25 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data
1152158112_1152158118 12 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158118 17:78648277-78648299 TCACAGAGGCTCCAAGGCTGAGG No data
1152158112_1152158116 -2 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158116 17:78648263-78648285 GGCTGAACACAGAATCACAGAGG No data
1152158112_1152158117 6 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158117 17:78648271-78648293 ACAGAATCACAGAGGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158112 Original CRISPR CCTCGGCCTTGCTGCAGTCC GGG (reversed) Intergenic