ID: 1152158114

View in Genome Browser
Species Human (GRCh38)
Location 17:78648243-78648265
Sequence GCCTCGGCCTTGCTGCAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158114_1152158116 -3 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158116 17:78648263-78648285 GGCTGAACACAGAATCACAGAGG No data
1152158114_1152158120 24 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data
1152158114_1152158117 5 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158117 17:78648271-78648293 ACAGAATCACAGAGGCTCCAAGG No data
1152158114_1152158118 11 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158118 17:78648277-78648299 TCACAGAGGCTCCAAGGCTGAGG No data
1152158114_1152158121 28 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158121 17:78648294-78648316 CTGAGGTCAGTTCAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158114 Original CRISPR GCCTCGGCCTTGCTGCAGTC CGG (reversed) Intergenic