ID: 1152158115

View in Genome Browser
Species Human (GRCh38)
Location 17:78648259-78648281
Sequence TGTGATTCTGTGTTCAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158115_1152158118 -5 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158118 17:78648277-78648299 TCACAGAGGCTCCAAGGCTGAGG No data
1152158115_1152158124 26 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158124 17:78648308-78648330 GTTGGAAGGCAGATGCCCAGGGG No data
1152158115_1152158120 8 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data
1152158115_1152158121 12 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158121 17:78648294-78648316 CTGAGGTCAGTTCAGTTGGAAGG No data
1152158115_1152158122 24 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158122 17:78648306-78648328 CAGTTGGAAGGCAGATGCCCAGG No data
1152158115_1152158123 25 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158123 17:78648307-78648329 AGTTGGAAGGCAGATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158115 Original CRISPR TGTGATTCTGTGTTCAGCCT CGG (reversed) Intergenic