ID: 1152158116

View in Genome Browser
Species Human (GRCh38)
Location 17:78648263-78648285
Sequence GGCTGAACACAGAATCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158114_1152158116 -3 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158116 17:78648263-78648285 GGCTGAACACAGAATCACAGAGG No data
1152158112_1152158116 -2 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158116 17:78648263-78648285 GGCTGAACACAGAATCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158116 Original CRISPR GGCTGAACACAGAATCACAG AGG Intergenic