ID: 1152158120

View in Genome Browser
Species Human (GRCh38)
Location 17:78648290-78648312
Sequence AAGGCTGAGGTCAGTTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158112_1152158120 25 Left 1152158112 17:78648242-78648264 CCCGGACTGCAGCAAGGCCGAGG No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data
1152158114_1152158120 24 Left 1152158114 17:78648243-78648265 CCGGACTGCAGCAAGGCCGAGGC No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data
1152158115_1152158120 8 Left 1152158115 17:78648259-78648281 CCGAGGCTGAACACAGAATCACA No data
Right 1152158120 17:78648290-78648312 AAGGCTGAGGTCAGTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158120 Original CRISPR AAGGCTGAGGTCAGTTCAGT TGG Intergenic