ID: 1152158365

View in Genome Browser
Species Human (GRCh38)
Location 17:78650121-78650143
Sequence CAGATGCGCAGGCCCTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158360_1152158365 -3 Left 1152158360 17:78650101-78650123 CCCCAGAGTCCAAGGCAGTTCAG No data
Right 1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG No data
1152158355_1152158365 23 Left 1152158355 17:78650075-78650097 CCAGGAGGGGAGCTCCAGTGAGG No data
Right 1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG No data
1152158358_1152158365 9 Left 1152158358 17:78650089-78650111 CCAGTGAGGGCGCCCCAGAGTCC No data
Right 1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG No data
1152158361_1152158365 -4 Left 1152158361 17:78650102-78650124 CCCAGAGTCCAAGGCAGTTCAGA No data
Right 1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG No data
1152158362_1152158365 -5 Left 1152158362 17:78650103-78650125 CCAGAGTCCAAGGCAGTTCAGAT No data
Right 1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158365 Original CRISPR CAGATGCGCAGGCCCTGCCT TGG Intergenic
No off target data available for this crispr