ID: 1152158389

View in Genome Browser
Species Human (GRCh38)
Location 17:78650225-78650247
Sequence GGCTGCTGGTCAGCTGGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158383_1152158389 5 Left 1152158383 17:78650197-78650219 CCCTTCTGTGCAGGGAGGAGGCT No data
Right 1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG No data
1152158380_1152158389 11 Left 1152158380 17:78650191-78650213 CCTGAGCCCTTCTGTGCAGGGAG No data
Right 1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG No data
1152158384_1152158389 4 Left 1152158384 17:78650198-78650220 CCTTCTGTGCAGGGAGGAGGCTC No data
Right 1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG No data
1152158379_1152158389 12 Left 1152158379 17:78650190-78650212 CCCTGAGCCCTTCTGTGCAGGGA No data
Right 1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158389 Original CRISPR GGCTGCTGGTCAGCTGGAAA CGG Intergenic
No off target data available for this crispr