ID: 1152158825

View in Genome Browser
Species Human (GRCh38)
Location 17:78654143-78654165
Sequence CAGGGTAGTGTGCGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152158825_1152158834 21 Left 1152158825 17:78654143-78654165 CCAGCATCCCGCACACTACCCTG No data
Right 1152158834 17:78654187-78654209 ATTTGTTGAATTGGACCAAATGG No data
1152158825_1152158833 12 Left 1152158825 17:78654143-78654165 CCAGCATCCCGCACACTACCCTG No data
Right 1152158833 17:78654178-78654200 TGCATGAGTATTTGTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152158825 Original CRISPR CAGGGTAGTGTGCGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr