ID: 1152160915

View in Genome Browser
Species Human (GRCh38)
Location 17:78668150-78668172
Sequence CTGGTGAGTAGCAGAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152160915_1152160919 4 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160919 17:78668177-78668199 GACTTGCCCCAGTCCTTCTTTGG No data
1152160915_1152160927 16 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160927 17:78668189-78668211 TCCTTCTTTGGGGCCTGGGAAGG No data
1152160915_1152160929 19 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160929 17:78668192-78668214 TTCTTTGGGGCCTGGGAAGGAGG No data
1152160915_1152160924 11 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160924 17:78668184-78668206 CCCAGTCCTTCTTTGGGGCCTGG No data
1152160915_1152160921 6 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160921 17:78668179-78668201 CTTGCCCCAGTCCTTCTTTGGGG No data
1152160915_1152160926 12 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160926 17:78668185-78668207 CCAGTCCTTCTTTGGGGCCTGGG No data
1152160915_1152160931 21 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160931 17:78668194-78668216 CTTTGGGGCCTGGGAAGGAGGGG No data
1152160915_1152160930 20 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160930 17:78668193-78668215 TCTTTGGGGCCTGGGAAGGAGGG No data
1152160915_1152160920 5 Left 1152160915 17:78668150-78668172 CCATCAACTCTGCTACTCACCAG No data
Right 1152160920 17:78668178-78668200 ACTTGCCCCAGTCCTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152160915 Original CRISPR CTGGTGAGTAGCAGAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr