ID: 1152161488

View in Genome Browser
Species Human (GRCh38)
Location 17:78671168-78671190
Sequence GTGCAATTCCGGCCCGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152161488_1152161497 14 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161497 17:78671205-78671227 GCCCACAGCGGGTAGCAGCAGGG No data
1152161488_1152161493 -8 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161493 17:78671183-78671205 AATTGCACAGGCACACATAGGGG No data
1152161488_1152161500 24 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161500 17:78671215-78671237 GGTAGCAGCAGGGTCAGTCGCGG No data
1152161488_1152161492 -9 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161492 17:78671182-78671204 GAATTGCACAGGCACACATAGGG No data
1152161488_1152161491 -10 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161491 17:78671181-78671203 GGAATTGCACAGGCACACATAGG No data
1152161488_1152161495 3 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG No data
1152161488_1152161501 25 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161501 17:78671216-78671238 GTAGCAGCAGGGTCAGTCGCGGG No data
1152161488_1152161496 13 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161496 17:78671204-78671226 GGCCCACAGCGGGTAGCAGCAGG No data
1152161488_1152161494 2 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161494 17:78671193-78671215 GCACACATAGGGGCCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152161488 Original CRISPR GTGCAATTCCGGCCCGTTCC AGG (reversed) Intergenic
No off target data available for this crispr