ID: 1152161490

View in Genome Browser
Species Human (GRCh38)
Location 17:78671179-78671201
Sequence TATGTGTGCCTGTGCAATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152161490_1152161495 -8 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG No data
1152161490_1152161500 13 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161500 17:78671215-78671237 GGTAGCAGCAGGGTCAGTCGCGG No data
1152161490_1152161497 3 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161497 17:78671205-78671227 GCCCACAGCGGGTAGCAGCAGGG No data
1152161490_1152161496 2 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161496 17:78671204-78671226 GGCCCACAGCGGGTAGCAGCAGG No data
1152161490_1152161501 14 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161501 17:78671216-78671238 GTAGCAGCAGGGTCAGTCGCGGG No data
1152161490_1152161494 -9 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161494 17:78671193-78671215 GCACACATAGGGGCCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152161490 Original CRISPR TATGTGTGCCTGTGCAATTC CGG (reversed) Intergenic