ID: 1152161501

View in Genome Browser
Species Human (GRCh38)
Location 17:78671216-78671238
Sequence GTAGCAGCAGGGTCAGTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152161488_1152161501 25 Left 1152161488 17:78671168-78671190 CCTGGAACGGGCCGGAATTGCAC No data
Right 1152161501 17:78671216-78671238 GTAGCAGCAGGGTCAGTCGCGGG No data
1152161490_1152161501 14 Left 1152161490 17:78671179-78671201 CCGGAATTGCACAGGCACACATA No data
Right 1152161501 17:78671216-78671238 GTAGCAGCAGGGTCAGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152161501 Original CRISPR GTAGCAGCAGGGTCAGTCGC GGG Intergenic
No off target data available for this crispr