ID: 1152161877

View in Genome Browser
Species Human (GRCh38)
Location 17:78673999-78674021
Sequence CTCAGGCGGGGCCCTCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152161877_1152161885 6 Left 1152161877 17:78673999-78674021 CCACCTCGAGGGCCCCGCCTGAG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1152161885 17:78674028-78674050 GACACCGCGAACAACAAAGATGG 0: 1
1: 0
2: 0
3: 1
4: 60
1152161877_1152161887 11 Left 1152161877 17:78673999-78674021 CCACCTCGAGGGCCCCGCCTGAG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1152161887 17:78674033-78674055 CGCGAACAACAAAGATGGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1152161877_1152161889 21 Left 1152161877 17:78673999-78674021 CCACCTCGAGGGCCCCGCCTGAG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1152161889 17:78674043-78674065 AAAGATGGCTTGGGCAGAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 281
1152161877_1152161888 12 Left 1152161877 17:78673999-78674021 CCACCTCGAGGGCCCCGCCTGAG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1152161888 17:78674034-78674056 GCGAACAACAAAGATGGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152161877 Original CRISPR CTCAGGCGGGGCCCTCGAGG TGG (reversed) Intergenic
900614837 1:3560822-3560844 CTCAGGCGTCGGCCGCGAGGGGG + Intronic
901490690 1:9594976-9594998 CTCAAGCGGTGTCCTCGAGCTGG + Intronic
902193893 1:14783698-14783720 CTCAGGCGGTGGCCTTGAGCGGG + Intronic
902805888 1:18861162-18861184 CTCAGACTGGGCCCTGAAGGAGG - Intronic
903559048 1:24214282-24214304 CTCAGGCAAAGCCCTTGAGGTGG - Intergenic
907248620 1:53123333-53123355 CTCAGGCGGGGCCATCCTGTGGG + Intronic
916078505 1:161217645-161217667 CTCAGATGGGTCCCTTGAGGTGG + Intronic
918176340 1:182048983-182049005 CTCAGCCAGGGACCTTGAGGAGG + Intergenic
920021296 1:202958339-202958361 CCCAGGCAGAGCCCGCGAGGAGG - Exonic
921261456 1:213388435-213388457 CTCAGGTGGGGGCCTGGTGGGGG + Intergenic
922419131 1:225447675-225447697 GTTAGGAGGGGCCCTCGGGGAGG - Intergenic
922758432 1:228109478-228109500 CCCAGGCGGGGCCGGCGAGCAGG + Intergenic
923894093 1:238249877-238249899 CTCATGCAGGGCCCTGGAAGGGG + Intergenic
1067462328 10:46466789-46466811 CTCAGGGTGGGCCCTGGAAGTGG + Intergenic
1067624869 10:47917848-47917870 CTCAGGGTGGGCCCTGGAAGTGG - Intergenic
1071086851 10:81875294-81875316 CTCTGCCGCGGCCCTCGGGGGGG + Exonic
1076461263 10:130649050-130649072 GTCAGCTGGGGCCCTCGAAGTGG - Intergenic
1076824017 10:132958235-132958257 CACAGGCAGGACCCTCGATGTGG - Intergenic
1076845456 10:133067271-133067293 CTCAGGCCGGACTCTAGAGGGGG + Intergenic
1077112411 11:867714-867736 CTCAGGAGGAGCCCCCGGGGTGG - Intergenic
1077177145 11:1196141-1196163 GTCAGGGGGGGACCTGGAGGAGG + Intronic
1077212981 11:1382064-1382086 CTCAGTGGGGGCCATCGTGGGGG + Intergenic
1077441555 11:2571441-2571463 CTCAGGAGGGGTGCTCGGGGTGG - Intronic
1077916067 11:6612153-6612175 CTCCGGCGCGGACCCCGAGGCGG - Exonic
1081781573 11:45716674-45716696 CTCTAGCGGGGCCTTCTAGGGGG + Intergenic
1081802242 11:45868010-45868032 CTCAGGTGTGACCCTAGAGGTGG + Intronic
1082996062 11:59256465-59256487 CTCAGGCAAGGCCCTGCAGGAGG - Intergenic
1084359401 11:68659845-68659867 CCCAGGAGGGGCCTTGGAGGTGG + Intergenic
1089527586 11:119107437-119107459 GTCCGGCGGGGCCCGCGCGGTGG + Exonic
1090461134 11:126892423-126892445 CTCAGGAGGGGCCCTGGGAGAGG + Intronic
1095223988 12:39656604-39656626 CTCAGGCAGGGCCTTTCAGGAGG + Intronic
1104980212 12:132570237-132570259 CTCAGGTGGGGTCCCCGCGGGGG + Exonic
1105454205 13:20525668-20525690 CTCGCGTGGGGCCCTCGGGGTGG - Intronic
1108164354 13:47676735-47676757 CTCAGGGAGGGCACTAGAGGAGG + Intergenic
1113768899 13:112896272-112896294 CTCAGGAGGAGGCCTCGGGGGGG - Intronic
1119035988 14:71231084-71231106 CTCGGGCGGTGGCCTCCAGGGGG - Intergenic
1119173169 14:72549926-72549948 CCCTGGCAGGGCCCTAGAGGAGG - Intronic
1122037861 14:98961491-98961513 CTGAGGAGGGGCCCTGGAGGGGG - Intergenic
1122578401 14:102756071-102756093 CTCCGGAGGGTCCCTCGGGGAGG - Intergenic
1122788943 14:104176363-104176385 CCCAGGCCGGGCCCTCGCGGTGG + Exonic
1124645727 15:31436537-31436559 CTCATGCCGGGCCCTGGGGGTGG - Intergenic
1125576208 15:40757326-40757348 CTCAGGCTGGGCTGTGGAGGGGG - Intergenic
1125607955 15:40952946-40952968 CTCAGGAGGGGCCCCAGAGACGG + Intronic
1128067739 15:64775235-64775257 CTCCGGCGGCGCCCTGGAGGAGG - Exonic
1128841496 15:70854294-70854316 CGCAGGCGGGGCCTCGGAGGTGG + Intronic
1129704702 15:77787533-77787555 CTCAGGCTGGGGACTGGAGGGGG + Intronic
1129844325 15:78761303-78761325 CTCAGCCAGGGCCCTCAAGCTGG - Intronic
1131508632 15:93036712-93036734 CTGGGGCGGGGCGCTCCAGGGGG - Intronic
1132285396 15:100658717-100658739 CTCAGGAGGGGGCCTCCAGGCGG + Intergenic
1132457847 16:33919-33941 CTCAGGGAGGGCCTTCCAGGAGG + Intergenic
1132620855 16:867733-867755 CTGAGGCCGGGCCCATGAGGAGG + Intronic
1132997423 16:2830465-2830487 CCCAGGTGGGGCCCCCCAGGAGG - Exonic
1134052114 16:11144590-11144612 CTCAGGCGTGGGCCTCAAGCTGG - Intronic
1137404632 16:48179715-48179737 CACAGGAGGGGCCCTGGATGAGG + Intronic
1137447160 16:48538979-48539001 CTCAGGCTGGGCCTTCCAGGAGG + Exonic
1138186366 16:54980930-54980952 TTCAGGCTGGGCCCTGGAGATGG + Intergenic
1139549856 16:67667154-67667176 GCCAGGCTGGGCCCTCCAGGCGG + Intronic
1143496379 17:7315108-7315130 CTCAGACGGGGCCTGCGGGGAGG + Exonic
1144653010 17:17018889-17018911 CTAGGGAGGGGCCCTGGAGGGGG - Intergenic
1147580887 17:41626489-41626511 CTGTGCCGTGGCCCTCGAGGTGG + Intergenic
1148223207 17:45879672-45879694 CTCAGGCAGGGCCTTCGTGAGGG - Intergenic
1148444399 17:47728711-47728733 CTCAGGCTGGGCCTGCGAGAGGG - Intergenic
1152161877 17:78673999-78674021 CTCAGGCGGGGCCCTCGAGGTGG - Intergenic
1152575107 17:81136494-81136516 CTGAGGTGGGGTCCTGGAGGTGG - Intronic
1152640421 17:81447138-81447160 CTCAGGCTGGGCCCCCGGGGCGG - Exonic
1153997448 18:10454570-10454592 CGGAGGAGGGGCCCTGGAGGGGG - Intergenic
1156521889 18:37728897-37728919 CTCAGACAGGGCACTGGAGGTGG - Intergenic
1158530476 18:58256035-58256057 CTGGGGCGAGGCCCTCGTGGTGG - Intronic
1160982757 19:1823768-1823790 CGCAGGTGGAGCCCCCGAGGAGG - Exonic
1161111916 19:2475456-2475478 CACTTTCGGGGCCCTCGAGGAGG + Intergenic
1161354043 19:3809384-3809406 CTGAGGCGGGCCCCACGTGGTGG - Intronic
1161739492 19:6011865-6011887 CTCAGGGGGGGCACTTGTGGAGG + Intronic
1162464036 19:10830194-10830216 ATCAGGGGGGGCCCTGGAGTGGG - Exonic
1163706012 19:18813769-18813791 CACAGACGTGGCCCTCGCGGTGG - Intergenic
1166345639 19:42163535-42163557 GTCAGCAGGGGCCCTTGAGGAGG - Intronic
1166834307 19:45657939-45657961 CTCAGCTGGGGCCCTAGAGACGG - Intergenic
1166873212 19:45883098-45883120 CTCTGGCGGTGCCCCAGAGGCGG - Intergenic
931869868 2:66445927-66445949 CTCCGGCAGGGACCTCCAGGCGG - Intronic
932345009 2:70989494-70989516 CTCAGGATGACCCCTCGAGGGGG + Intronic
932448620 2:71795715-71795737 CTGAGGCTGTGCCCTCCAGGAGG + Intergenic
937203739 2:120223056-120223078 CTTGGGCGGGGCCCGGGAGGCGG - Exonic
945404014 2:209423824-209423846 GCCAGGCGGGGACCGCGAGGTGG - Intergenic
946419612 2:219557541-219557563 CCCAGGCGGGGACCTAGAGCTGG - Exonic
948846037 2:240683241-240683263 TTCAGGCAGGGACCTGGAGGGGG - Intergenic
948847819 2:240691488-240691510 TTCAGGCAGGGACCTGGAGGGGG + Intergenic
1168874887 20:1164609-1164631 ATCAGGCAGGGCCCTGGAGGAGG - Intronic
1171423220 20:25032776-25032798 CACAGGCAGGGGCCTCAAGGAGG + Intronic
1171959549 20:31484151-31484173 CGCAGGCGCGGCCCTCTAAGGGG - Exonic
1172835337 20:37869688-37869710 CTCAGGAGGGGACCCGGAGGAGG + Intronic
1176081773 20:63277058-63277080 CTGAGCAGGGGCCGTCGAGGGGG + Intronic
1176306088 21:5123812-5123834 CTCAGGCAGGGCCATGGGGGCGG + Intronic
1179727435 21:43348331-43348353 CCCAGGTGGGGCCCCCGAGGTGG - Intergenic
1179842064 21:44083209-44083231 CTCAGGGGTGGCTCTGGAGGAGG + Exonic
1179850969 21:44138219-44138241 CTCAGGCAGGGCCATGGGGGCGG - Intronic
1180000716 21:44994128-44994150 AGCAGGCGGGGCCCTCAGGGAGG - Intergenic
1180064225 21:45404874-45404896 CTCGGGCGGTTCCCTCGGGGCGG + Intergenic
1180177352 21:46097424-46097446 CTCAGGTGGGGACCTCACGGTGG + Intergenic
1180782289 22:18528071-18528093 CGCAGGCTGGGTCCCCGAGGCGG + Exonic
1180967058 22:19795876-19795898 CTCAGGCAGGGGCCTCTTGGTGG - Intronic
1181125839 22:20702097-20702119 CGCAGGCTGGGTCCCCGAGGCGG + Intergenic
1181239177 22:21467409-21467431 CGCAGGCTGGGTCCCCGAGGCGG + Intergenic
1181514089 22:23401706-23401728 CTCAGGGGGGGCCCTTCACGGGG + Intergenic
1181737331 22:24892219-24892241 CTCAGGCGAGGCCCTTGGGCAGG + Intronic
1182021017 22:27081527-27081549 CTCATGCTCTGCCCTCGAGGAGG - Intergenic
1183824001 22:40370740-40370762 CTCAGGCGGGGGCTGCGGGGCGG + Intronic
1184103815 22:42355730-42355752 TTCATGCGGGGCCCTGGATGTGG + Intergenic
1184210735 22:43034130-43034152 CTCAGGCGGTGCCCTAGGGACGG - Intergenic
1184412464 22:44332838-44332860 CTCTCTTGGGGCCCTCGAGGAGG - Intergenic
1184519836 22:44986841-44986863 TGCAGGCGGGGTCCTGGAGGTGG + Intronic
1184596472 22:45517113-45517135 TCCAGGCTGGGCCCTCGGGGTGG - Intronic
1184646155 22:45896546-45896568 CTCAGGAGGGAGCCTCGTGGTGG + Intergenic
1185218961 22:49619425-49619447 CTCAGCCTGGGCCCTGGACGAGG + Intronic
950634892 3:14307745-14307767 CTTAGGCGCTGGCCTCGAGGAGG - Intergenic
954301402 3:49702555-49702577 CTCAGGCAGGGCCTTGGATGAGG + Intronic
959481073 3:106873295-106873317 CTCAGGTGGGTCCCCAGAGGAGG - Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
968089504 3:195891661-195891683 CTGAGGCTGAGCCCTGGAGGGGG - Intronic
968810878 4:2799197-2799219 CCCAGGCGGGACCCTGGGGGTGG + Intronic
969696500 4:8738057-8738079 CTCGGGGAGGGCCCTCGTGGTGG + Intergenic
972738284 4:41866312-41866334 CGCACGCTGGGCCCCCGAGGCGG - Intergenic
982090083 4:151872782-151872804 CTCAGGATGGGCCTTGGAGGAGG + Intergenic
985535668 5:464605-464627 CTGTGGCATGGCCCTCGAGGTGG + Intronic
985645884 5:1084581-1084603 CTCAGGACGGGTCCCCGAGGGGG + Intronic
998172154 5:139878847-139878869 CCCAGGCTGGGCCATAGAGGAGG + Intronic
1002591009 5:180291788-180291810 CTCGGGCCGGGCCCGCGGGGAGG - Intronic
1003573050 6:7268569-7268591 CTCAGGAGGGGCGGTGGAGGGGG - Intronic
1007498351 6:42277288-42277310 CCCAGCCAGGGCCCTGGAGGTGG - Intronic
1007659860 6:43477502-43477524 CTGAGGCGGGGCCATGGGGGCGG - Exonic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019538691 7:1541792-1541814 CACAGGAGGGACCCTCAAGGCGG - Exonic
1019731669 7:2632434-2632456 CTCAGAAGGGACCCTCGAGAAGG - Intronic
1019738992 7:2663556-2663578 CTGTGGCGGGGCCTCCGAGGGGG - Exonic
1023868715 7:44251517-44251539 CCCAGGAGGGGCTCTCCAGGAGG + Intronic
1024055440 7:45657428-45657450 GTCAGGGAGGGCCCTCTAGGAGG + Intronic
1026916128 7:74121280-74121302 CTCAGTCGGGGACCTCAGGGTGG - Exonic
1029228497 7:99046903-99046925 CTCAGGCCCAGCCCTCGCGGTGG + Intronic
1030227545 7:107169408-107169430 CTCGGGCGGGGGCCGGGAGGAGG + Intronic
1034984029 7:155496519-155496541 CTCAGGCGGGACACTCCAAGGGG + Intronic
1035235246 7:157493599-157493621 CGCAGGAATGGCCCTCGAGGAGG - Intergenic
1038692461 8:29775553-29775575 CTCAGGTGGGGCTGTCTAGGGGG + Intergenic
1045482088 8:102600818-102600840 CTTAGGCCGGGCCCTCCAGGAGG - Intergenic
1048163924 8:132045346-132045368 CTCAGGTGGGTCCCTGAAGGTGG - Intronic
1048469106 8:134691339-134691361 CTCAGGCGGGGCTCAGGTGGTGG + Intronic
1056031756 9:82560720-82560742 CCCAGGCAGGCCCTTCGAGGAGG + Intergenic
1059423512 9:114206881-114206903 CTCAGGAGGGGGCCACCAGGTGG + Intronic
1060235162 9:121857498-121857520 CTCACGCCAGGCCTTCGAGGTGG - Intronic
1060773134 9:126347162-126347184 ATGAGGCAGGGCCCTTGAGGGGG + Intronic
1061406615 9:130395905-130395927 CCCTGGCGGGGCTCTCCAGGAGG + Intronic
1062196329 9:135276217-135276239 CTCAGGTGGAGGCCTCTAGGAGG - Intergenic
1062230675 9:135479980-135480002 CGCAGGCGGGGTCCGCGCGGCGG + Exonic
1062653660 9:137590902-137590924 CTCGTGCGGGGCCCTCTGGGCGG + Intergenic
1189988584 X:46574585-46574607 CGCAGGCGGTGTCCTCGACGAGG - Exonic
1199783666 X:151084770-151084792 CTCAGGTGGGCTCCTCCAGGAGG - Intergenic
1200218541 X:154379450-154379472 CTCAGGCGGAGGCCTGGCGGCGG - Exonic
1200238760 X:154482789-154482811 CTCCAGCTGGGCCCTGGAGGAGG + Intergenic