ID: 1152165390

View in Genome Browser
Species Human (GRCh38)
Location 17:78701492-78701514
Sequence GGGAATGACTGGATGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152165390 Original CRISPR GGGAATGACTGGATGGTCAA GGG (reversed) Intronic
903340229 1:22649295-22649317 GGGAGGGACTGCATGGGCAAAGG - Intergenic
904910062 1:33927966-33927988 AGGAATGCATGGAAGGTCAAGGG + Intronic
905554448 1:38871266-38871288 GTGAAAGACTGAATGGTAAAAGG - Intronic
906667569 1:47632316-47632338 GCCAAAGACTGGATGGTCCAGGG + Intergenic
906874463 1:49521915-49521937 GGGAATGAGTGCAGGGGCAAGGG + Intronic
911012377 1:93294634-93294656 GGGAAAGTGTGGATGGTTAATGG + Intergenic
912933200 1:113982296-113982318 GGGAGAAACTGGATGGTCAGGGG - Intergenic
913405734 1:118488828-118488850 TGGAATGACGGGATAGTCCATGG + Intergenic
916697115 1:167249610-167249632 GGGAGTGAATTGATGGTCTAGGG + Intronic
917899137 1:179524642-179524664 GTGATTGACTGGATGGACACGGG - Intronic
918130707 1:181626013-181626035 GGGAATGAATGGCAGGTCAATGG + Intronic
919072148 1:192769338-192769360 GGGAAAAAGTGGATGGTTAATGG + Intergenic
919183127 1:194111301-194111323 AGGAATTACTGGATGGTTATTGG + Intergenic
919907328 1:202086937-202086959 GGGAATGGCAGGAGGGTCTATGG + Intergenic
920689650 1:208136138-208136160 GGGACTGACTAGAAGGACAAGGG - Intronic
921816172 1:219566414-219566436 TGGAATGAATGGATGATGAATGG - Intergenic
922213318 1:223501511-223501533 GGGAAGGACTGGGGGGTCATGGG + Intergenic
922790895 1:228310394-228310416 GTGGATGAGTGGATGGTGAATGG - Intronic
924504114 1:244664849-244664871 GGGAAGGACTGGAAGATGAAAGG - Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1064419212 10:15175989-15176011 GGGAAAGAGGGGATGGTTAATGG + Intergenic
1064842426 10:19609528-19609550 GGGAATTACTGGATGCTGTAAGG - Intronic
1067348829 10:45457392-45457414 GGGAATTAGTGGATGCTAAATGG - Exonic
1069976565 10:72217845-72217867 AGCACTGACAGGATGGTCAAAGG + Intronic
1074028975 10:109665193-109665215 GGGAATGACTGTGAGGACAAAGG - Intergenic
1074169928 10:110921790-110921812 GGGAATGTGGGGATGGTTAATGG - Intronic
1076425470 10:130364389-130364411 GGGGATAACTGGGTGGACAAGGG - Intergenic
1076993074 11:285558-285580 GGGAATGGCTGGAGGGTCTCAGG - Intergenic
1078775435 11:14389453-14389475 GTGAGTGACTGGCTGGGCAAAGG - Intergenic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1086300097 11:85418679-85418701 GGGAATTACTTAATGGTAAAGGG - Intronic
1087387994 11:97497504-97497526 GGGAAGGGCTGGATGGAGAAAGG - Intergenic
1089124242 11:116165061-116165083 GGGCATCACTGGATGCTCAGTGG - Intergenic
1089351619 11:117824660-117824682 GGAAATGACTGGGTTGTCGATGG - Exonic
1089351987 11:117826844-117826866 GGAAATGACTGGGTTGTCAATGG - Intronic
1089529688 11:119118842-119118864 GGGAATGAGTAGATGGTAACTGG + Intergenic
1090152497 11:124400461-124400483 GGGAATGAGATGTTGGTCAAAGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090756528 11:129796662-129796684 GGAAATGACTGTATTGTGAAAGG + Intergenic
1092685873 12:11045290-11045312 GGGAAGGAGTGGCTGGTTAATGG + Intronic
1093244741 12:16722361-16722383 GGGATTGGCTGAATGGTAAAAGG + Intergenic
1094175205 12:27534159-27534181 AGGAATGAGTGCATGGTCCAGGG + Intronic
1094449040 12:30564566-30564588 TGGGATGACTGGATGGGGAAGGG + Intergenic
1094477069 12:30849078-30849100 GGAAATGACTGGTTGTTTAAAGG + Intergenic
1096370967 12:51068698-51068720 GTGAATGACTGGATGATCCTTGG + Intronic
1098313255 12:69168469-69168491 GGCAATGACAGGAAGGTGAATGG + Intergenic
1100241066 12:92711038-92711060 TGGATTGGCTGGATGGTCAGGGG - Intergenic
1100271378 12:93028690-93028712 GGGTATGAATAGATGGTCAGTGG - Intergenic
1101102000 12:101403588-101403610 GGTCATGGCTGGGTGGTCAAAGG + Intronic
1101172580 12:102114319-102114341 TGGAATTACTGGGTGGTCATGGG + Intronic
1102877988 12:116462530-116462552 GGGAATGAGTTGCTGGTAAAAGG - Intergenic
1103052379 12:117791304-117791326 GGGAGTGACTGGGAGGTCAAGGG - Intronic
1103175038 12:118855602-118855624 GGGTATGACTGGAAGGGAAAGGG + Intergenic
1103862312 12:124025012-124025034 GGGAATGGCTGCATGGGCCAGGG + Intronic
1107442185 13:40437915-40437937 GGGAATGGCTTCTTGGTCAAGGG - Intergenic
1108935111 13:55873194-55873216 TAGAATGGCTGGATTGTCAATGG + Intergenic
1109500124 13:63224715-63224737 TGGAATAACTGGCTAGTCAAAGG - Intergenic
1109882848 13:68504074-68504096 GGTAAAGACTTGTTGGTCAAAGG + Intergenic
1110823464 13:79943863-79943885 GGGAGTGACTGGTTGTGCAATGG - Intergenic
1112955801 13:105056722-105056744 GGGATTGGGTGGATGGTGAATGG - Intergenic
1119602327 14:75984779-75984801 GGGAAGGCCTGGATGGACACAGG - Intronic
1120244428 14:81989978-81990000 TGGAATGAATGGATGAACAATGG + Intergenic
1120998546 14:90435125-90435147 GGGAAAGACTGGATCATCCAGGG - Intergenic
1121088994 14:91168377-91168399 GGGGATGACTGGAGTGTCAGGGG - Intronic
1121983257 14:98473775-98473797 GGGAATGAATGGTTAGTTAATGG - Intergenic
1123010809 14:105348725-105348747 GGGAATGACAGGATGCTCCTGGG + Intronic
1123981110 15:25604584-25604606 GGGGAGGTGTGGATGGTCAATGG + Intergenic
1125756958 15:42070889-42070911 GGGAATCGCAGGATGGTCAGAGG + Intronic
1128838537 15:70831029-70831051 GAGAACCACTGGATGGACAAAGG - Exonic
1129412929 15:75359779-75359801 AGGAAAGACTGGCTGGTCATAGG + Intronic
1133754385 16:8751600-8751622 GGCGATGACTGGCTGGTGAAGGG - Intronic
1134339270 16:13330108-13330130 GGGAATGACTATATGGCCGAGGG + Intergenic
1134563741 16:15232860-15232882 GGGAATGTAGGGATGGTTAATGG + Intergenic
1134738752 16:16523833-16523855 GGGAATGTAGGGATGGTTAATGG - Intergenic
1134928747 16:18188320-18188342 GGGAATGTAGGGATGGTTAATGG + Intergenic
1138024345 16:53511195-53511217 GGAAATGAGGGGATGGTGAAGGG + Intergenic
1139177212 16:64702420-64702442 GGAGATGACAGGAAGGTCAAAGG + Intergenic
1139969782 16:70766633-70766655 GGGAATGACTGCTTGGTACATGG - Intronic
1140116108 16:72042961-72042983 GTGAATGACTGGAAGAACAAGGG - Intergenic
1141286381 16:82676348-82676370 GGGAAAAACTGGATGGAGAATGG - Intronic
1142808501 17:2384447-2384469 GGGAATGCCTGGAGGGTAACTGG - Exonic
1146398045 17:32484325-32484347 GGGAAAGGCTGGCTGGACAAAGG + Intergenic
1146539231 17:33680257-33680279 GGGAATGGCTGGAGGGTCACTGG + Intronic
1148907800 17:50922271-50922293 AGGAATGGTTGGATGGTGAATGG + Intergenic
1149156177 17:53632450-53632472 GGAAATGACTGGTTGTTTAAAGG + Intergenic
1150056676 17:62023114-62023136 GGGAGAGAAAGGATGGTCAAGGG + Intronic
1151239285 17:72745199-72745221 GGTAATGAGTGGATGGGAAAGGG + Intronic
1152165390 17:78701492-78701514 GGGAATGACTGGATGGTCAAGGG - Intronic
1156067149 18:33157246-33157268 GTGTATGACTGGAAAGTCAAAGG - Intronic
1158185643 18:54768327-54768349 GGCAATGGCTGCATGGTGAAAGG + Intronic
1158224517 18:55186774-55186796 GGCAATGACTGGCTGGTTGATGG + Intergenic
1159026957 18:63192157-63192179 GGGAATGATTGGGTGTTCCAGGG + Intronic
1162956383 19:14100913-14100935 GGGAAGCAGTGGCTGGTCAAGGG + Intronic
1163609847 19:18295166-18295188 GGGGATGAGTGGATGGTGGATGG - Intergenic
1165206972 19:34197900-34197922 GCTTATGACTGGAGGGTCAAGGG + Intronic
1165285472 19:34838450-34838472 GGGAGTGTCTGGAAGATCAACGG - Intergenic
1165968280 19:39603351-39603373 GGGAAGAACTGGATGGGCTAGGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
926183336 2:10666040-10666062 GGGGATTACTGGATGGGGAAGGG - Intronic
927100895 2:19787070-19787092 GGCAGTGCCTGGATGGTTAAGGG + Intergenic
927936169 2:27078228-27078250 GGGAAGGACTGACTGGACAAGGG - Intergenic
928286620 2:29995569-29995591 GGAAATGACTGGATGGACACAGG - Intergenic
929289376 2:40171801-40171823 TCGTATGACTGGAAGGTCAAGGG + Intronic
929377647 2:41309137-41309159 GCCAAAGACTTGATGGTCAAAGG - Intergenic
933175224 2:79166464-79166486 GGGAATCACTGGAAGGCCCAGGG - Intergenic
935343705 2:102083466-102083488 TGGAATGTCTGAGTGGTCAAGGG + Intronic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
937157336 2:119730395-119730417 GAGTATAACTGGATGGTAAAAGG - Intergenic
937675053 2:124580994-124581016 GGGAATGCCTGGCTCCTCAAAGG + Intronic
938863718 2:135396687-135396709 GGGAAAGTCGGGATGGTTAATGG + Intronic
939477961 2:142710971-142710993 GGGAATGACATAATGGTAAAGGG - Intergenic
940801269 2:158135852-158135874 CGGAATGACTGGATGGGGGATGG + Exonic
941592600 2:167438406-167438428 GTGAATGACTGTTTGGTCAAAGG + Intergenic
942276983 2:174330271-174330293 GGGAAAGACTGGTGTGTCAAAGG - Intergenic
943404966 2:187470607-187470629 TTGGATGACTGGATAGTCAAAGG - Intronic
945469405 2:210210203-210210225 GGAAGTGACTGGATTCTCAATGG - Exonic
1169319379 20:4618689-4618711 GGGAATCACTGATTGGTCGAAGG + Intergenic
1173324177 20:42017511-42017533 AGGAATGGCTGGATGTTCAGAGG - Intergenic
1174885964 20:54334760-54334782 GGGAATGACTGGGTGGTATTGGG + Intergenic
1179249442 21:39660800-39660822 GGGAAAGAGAGGATGGTGAAGGG + Exonic
1179458795 21:41519507-41519529 GGGAATGAATGGAGATTCAATGG + Intronic
1181261966 22:21604816-21604838 GGGGATCTGTGGATGGTCAAAGG - Intronic
1182236746 22:28882929-28882951 GGGAAGGCCGGGATGGTCAGGGG - Intergenic
952814931 3:37438889-37438911 GGGAAGGAATGGATGCTCACAGG + Intergenic
953666683 3:44930610-44930632 GGGAATGTCAGGAGGGGCAAGGG + Intronic
954995143 3:54874482-54874504 GGGAATGACTGGAAGTTAATAGG - Intronic
955462512 3:59199981-59200003 GGAAATGTGGGGATGGTCAATGG - Intergenic
955675781 3:61447677-61447699 TAGAATGACTGGAAGGCCAATGG - Intergenic
956449234 3:69356867-69356889 GGGAATGACTTCAGGTTCAATGG - Intronic
957670665 3:83297273-83297295 GGGAATAATTGTATGGCCAATGG + Intergenic
959110660 3:102118529-102118551 GGGAATGGGAAGATGGTCAAAGG - Intronic
961650584 3:128414939-128414961 GGCACTGACTGGATGATCGAGGG + Intergenic
968594388 4:1474693-1474715 GGCAAGGACAGGAAGGTCAAAGG + Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
971536953 4:27765025-27765047 GAGAATAACTGGATGTGCAAGGG - Intergenic
971979222 4:33732307-33732329 TGGTTTGACTGGATGGTCAGGGG - Intergenic
972249283 4:37282521-37282543 CAGACTGACTGGAAGGTCAATGG - Intronic
974608762 4:64187630-64187652 GGGAAAGTGGGGATGGTCAATGG - Intergenic
974647460 4:64713717-64713739 GGAAATGACTGGTTGCTTAATGG - Intergenic
976008794 4:80462037-80462059 GGGAATCCCAGGATGGCCAAAGG - Intronic
976915306 4:90366620-90366642 GAGAATGAGATGATGGTCAAAGG - Intronic
978634846 4:110792243-110792265 GGGAATGATTGGCTAGACAATGG + Intergenic
981172926 4:141645749-141645771 TGGTATGACTCAATGGTCAAGGG + Intronic
986472611 5:8091159-8091181 GGGCAGGCCTGCATGGTCAAGGG + Intergenic
986475417 5:8125353-8125375 GGGAAGGTGGGGATGGTCAATGG + Intergenic
986620599 5:9669169-9669191 GGGAATGACAGAATGGTAAAGGG + Intronic
987623371 5:20365921-20365943 GGCAATGAATGGAAGGCCAACGG - Intronic
988178997 5:27765586-27765608 GGGAGTGAGTGGTTGTTCAAGGG - Intergenic
989303493 5:39923057-39923079 GGTAATGGCTGGTTGGTCGATGG + Intergenic
991917730 5:71621764-71621786 GGGAATGTGAGGATGGTTAATGG + Intronic
992817462 5:80458314-80458336 GAGGATGGCTGGGTGGTCAAGGG - Intronic
992848104 5:80774834-80774856 GGGGATGAGGGGATGGTTAATGG + Intronic
994877527 5:105444818-105444840 GTGAGTCACTGGATAGTCAAAGG + Intergenic
997695084 5:135855007-135855029 GGGAATGGCTGGCTTGTCAGTGG + Intronic
997755744 5:136397906-136397928 GGGAATGATTTGTTGGTGAAAGG + Intergenic
1001337073 5:170807838-170807860 GGGAAAAACAGGATGGTGAATGG - Intronic
1001989860 5:176107425-176107447 GGGGATGAGTGGAAGGTTAACGG + Intronic
1002010020 5:176271591-176271613 GGGAGAGAATGGATGGTTAATGG + Intronic
1002216714 5:177640713-177640735 GGGAGAGAATGGATGGTTAATGG - Intergenic
1002227011 5:177730713-177730735 GGGGATGAGTGGAAGGTTAATGG - Intronic
1002267139 5:178043061-178043083 GGGGATGAGTGGAAGGTTAATGG + Intronic
1002591928 5:180296308-180296330 GGGGCTGACTGGAAGGTCTAAGG - Intergenic
1003402087 6:5799085-5799107 AGCAGTGACTGGATGGTCATTGG - Intergenic
1003455226 6:6275696-6275718 GGGAATGACTGTTTGGTTCATGG - Intronic
1003474070 6:6465246-6465268 GTGAATGCCTGGAAGATCAATGG - Intergenic
1005282398 6:24287765-24287787 GGGAAGGACTGAATGTACAATGG - Intronic
1005589203 6:27307610-27307632 GGGAATGAGCTGTTGGTCAAAGG - Intronic
1006263692 6:32897471-32897493 TGGTATGATTGGATAGTCAAAGG + Intergenic
1006432093 6:34003341-34003363 GGGAATGGCGGGATGGGGAAAGG - Intergenic
1008821949 6:55643577-55643599 GGGAAGGTGAGGATGGTCAATGG - Intergenic
1012716253 6:102675230-102675252 ATAAATGACAGGATGGTCAAAGG - Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014172239 6:118291626-118291648 GGGAATGCCTGGCAGCTCAAAGG - Intronic
1020788297 7:12594865-12594887 GGGAGTGAAGAGATGGTCAAGGG + Intronic
1022832592 7:34083497-34083519 GGAAATCACTGTATGGTCAATGG - Intronic
1023116975 7:36872239-36872261 GGGAATGGATGGATGGGCAGAGG + Intronic
1025819812 7:64951715-64951737 GGAAATGACTGGCTGTTTAAAGG - Intergenic
1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG + Intergenic
1028466522 7:91158749-91158771 GGTAAGGAATTGATGGTCAAAGG + Intronic
1028717328 7:93986454-93986476 GGTAATGACTGCATCATCAATGG + Intronic
1031127095 7:117787335-117787357 GGGAATGACTGGACATGCAATGG + Intronic
1033276971 7:139979081-139979103 GGGAATGACTGCAAGGTCTGAGG + Intronic
1034243803 7:149629103-149629125 GGGAATGCCTGGATGAAAAAGGG - Intergenic
1037581142 8:20246715-20246737 GGGAACGACTGGACTGTCACGGG - Exonic
1038249386 8:25888842-25888864 GTGATTGACTGGCTGTTCAAAGG - Intronic
1038413373 8:27375423-27375445 GGAAATGACTGGATGACCACTGG - Intronic
1038530432 8:28314189-28314211 GGGAATGACGAGGTGCTCAAAGG + Intergenic
1039401151 8:37270431-37270453 GGGAAAGACTGGAAGCTGAAAGG + Intergenic
1041919589 8:63167477-63167499 GGCAATGAATGGAAGGGCAAGGG + Intergenic
1042094219 8:65194504-65194526 GTGAAAGATTGGAAGGTCAATGG - Intergenic
1042494553 8:69441500-69441522 GGGAATGGCTGAATTGTCCACGG - Intergenic
1043259325 8:78177742-78177764 GAGAATTACAGGATGGTTAAGGG - Intergenic
1044223135 8:89693100-89693122 GGGAATGACTGGTTGGTCCATGG - Intergenic
1045731837 8:105251410-105251432 GGGAATGTGGGGATGGTTAATGG - Intronic
1046887779 8:119386917-119386939 TTGGATGACTGGATGATCAATGG + Intergenic
1047256329 8:123216112-123216134 GGAGGTGACTGGATGGGCAAAGG + Intergenic
1047338522 8:123958202-123958224 GGCAAAGACTGGATGGTCCGAGG + Intronic
1047526318 8:125637416-125637438 GGAAATGACTGGAGGCTAAAAGG - Intergenic
1047925684 8:129680287-129680309 GGGGATGGCTGGGTGGGCAATGG - Intergenic
1048823197 8:138398299-138398321 GGCAGTGACTGGATTTTCAAGGG + Intronic
1051313213 9:15799739-15799761 GGGAAGGTCGGGATGGTTAATGG - Intronic
1051798868 9:20908335-20908357 AGGAATGACTGTCTGGGCAATGG + Intronic
1053390382 9:37730922-37730944 TGGAATGACTGCAAGGACAAAGG + Intronic
1058879787 9:109276464-109276486 GGGAATGACTAGAGGGTCCTGGG + Intronic
1059083746 9:111277358-111277380 GGGCATGACTGGATGTTTGATGG + Intergenic
1059357651 9:113712375-113712397 GTGAATGACTAGATAGTCAATGG + Intergenic
1059975375 9:119710600-119710622 GGGAAAGAGGGGATGGTTAATGG + Intergenic
1061993897 9:134174535-134174557 GGGAAGCACTGGGTGGGCAAGGG - Intergenic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185781921 X:2855230-2855252 AGGTGTGACTGTATGGTCAACGG - Intronic
1188149113 X:26650344-26650366 GGAAATGACTGGTTGTTTAAAGG - Intergenic
1188974419 X:36656175-36656197 GGGAATGTGGGGATGGTTAATGG - Intergenic
1190435694 X:50422411-50422433 GGGAATGACTGAATGGGCAGGGG - Intronic
1192317855 X:70066285-70066307 GGGAAGAACTGGCTGGTCAAGGG + Intergenic
1192800093 X:74457516-74457538 GGCAATGACAAGAGGGTCAATGG - Intronic
1193406836 X:81110797-81110819 GGCAATGTTTGGATGGTAAAGGG + Intergenic
1194533150 X:95075370-95075392 GGAAATGACTGGTTGTTTAAAGG - Intergenic
1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG + Intergenic
1195557931 X:106248564-106248586 GGGAATGTCTGGGTGGTGAGGGG + Intergenic
1196994741 X:121369798-121369820 GGGAATGTGGGGATGGTTAATGG + Intergenic
1198837315 X:140818425-140818447 GGAAATGACTGGTTGTTTAAGGG - Intergenic