ID: 1152168052

View in Genome Browser
Species Human (GRCh38)
Location 17:78723667-78723689
Sequence TGCAGCCTGTGCGCAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152168052 Original CRISPR TGCAGCCTGTGCGCAAATGC TGG (reversed) Intronic
900598076 1:3491425-3491447 AGCAGCCTGTGCGCTGGTGCAGG - Intronic
904266833 1:29323190-29323212 TGCAGCCTGTGGGCAACTGGTGG + Intronic
904565941 1:31428572-31428594 CGCTGCCTGTGCGGAGATGCTGG + Intronic
904893768 1:33798885-33798907 TGCAGGCTTTGGGCACATGCTGG - Intronic
906060489 1:42945154-42945176 TGCATCCCATGAGCAAATGCAGG - Intronic
908686531 1:66726173-66726195 TCCAGCCTGCTTGCAAATGCAGG - Intronic
912013867 1:105006190-105006212 TGCAGCCACTGTGAAAATGCTGG - Intergenic
916697891 1:167258958-167258980 TACAGCCTGTACGCAAAATCTGG - Intronic
916724449 1:167510342-167510364 TGCCCCCTGTGGGCATATGCTGG - Intronic
917128894 1:171719085-171719107 TGCAGCCTGTGAGCCAAATCTGG - Intronic
918090903 1:181293907-181293929 TGCAGCCTGTGCCCAATGCCAGG - Intergenic
920570194 1:207010645-207010667 GACAGCCTGTGCCCAAATGCAGG + Intronic
1063471727 10:6292988-6293010 TGCAGCGTATGCTCAATTGCTGG + Intergenic
1070553067 10:77506278-77506300 TGCAGCCAGTGGGGAGATGCTGG - Intronic
1071438345 10:85667589-85667611 GACAGCCTGTGCTCACATGCTGG - Intronic
1072238551 10:93473988-93474010 TGCACCCTGTGGGCGAGTGCAGG - Intronic
1075907289 10:126092730-126092752 TGAAGCCTCTGCCCAAATGGGGG + Intronic
1079375445 11:19887863-19887885 GGCAGCTTGTGTGCACATGCTGG - Intronic
1079413137 11:20208498-20208520 TGGAGCCTGTGCCCAAAGGTAGG + Intergenic
1081533423 11:43980930-43980952 TGATGCCTGTGCTCAAATCCTGG - Intergenic
1083294811 11:61709657-61709679 TGCAGCCTGTGTGCCATTGGTGG + Intronic
1084517790 11:69645839-69645861 TGCAGCATGTGCACACCTGCTGG - Intronic
1089575753 11:119441894-119441916 TGCAGACGCTGAGCAAATGCTGG - Intergenic
1091657216 12:2354440-2354462 TGCAGCCTGTAGGGAAACGCCGG + Intronic
1092901044 12:13059557-13059579 TGCAGCCTGTGAGCTGATGCAGG + Intronic
1094491964 12:30966360-30966382 TGCAGACTGTGCGCACCTGCTGG - Intronic
1094611323 12:31998216-31998238 TCCAGCCTGTGCGACAAAGCGGG - Intergenic
1096619767 12:52856868-52856890 TGCAGCATGTGTCCAAATCCTGG - Intergenic
1102649324 12:114426932-114426954 TGCAGCTTGTGAGTAAAAGCTGG + Intergenic
1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG + Intergenic
1104808327 12:131603802-131603824 TCCAGGCTGTGGGCAAATTCAGG - Intergenic
1105824322 13:24108623-24108645 TGGAGCCTGGGAGTAAATGCCGG + Intronic
1111501399 13:89125056-89125078 TTCAGCCTGGGTGAAAATGCAGG + Intergenic
1113663665 13:112125758-112125780 TGCAGACTGTGGGGAAATCCCGG - Intergenic
1118110962 14:62719319-62719341 TGCAACCTGTGCAGATATGCAGG - Intronic
1122976183 14:105171721-105171743 TGCCACCTGTATGCAAATGCTGG - Intergenic
1123704166 15:22939039-22939061 TGCAGGCTGTGTGCAAGGGCAGG + Intronic
1126222546 15:46231020-46231042 TTCAGCCTGTGCACACAAGCAGG - Intergenic
1132519121 16:379337-379359 AGCAGCCTGTCGGCAAATCCAGG + Intronic
1133121277 16:3610068-3610090 TGTCGCCTGTGTGCAAAGGCTGG + Intronic
1133737580 16:8627588-8627610 TGCAGCCTGTGAGCCAAATCTGG + Intronic
1137566974 16:49539379-49539401 TGCAGCCGATGAGCAAATGAGGG - Intronic
1140069132 16:71634188-71634210 TGCAGCCTGCTGCCAAATGCTGG + Intronic
1141015191 16:80442328-80442350 TGCACCCTGGGCTCAAATGTTGG - Intergenic
1144396846 17:14852718-14852740 TGCAAGCTGTGCTCAAGTGCTGG + Intergenic
1144439225 17:15266366-15266388 TGCTGGCTGTGAGCAGATGCTGG - Intergenic
1151363354 17:73601772-73601794 TCCAGCCTGGGCGAAAAAGCAGG - Intronic
1152168052 17:78723667-78723689 TGCAGCCTGTGCGCAAATGCTGG - Intronic
1154955055 18:21245070-21245092 TGCAGCCTTTGGGCTAATGATGG + Intronic
1159964871 18:74585310-74585332 TGCAACCTGTGCACAGATGTTGG - Intronic
1160418500 18:78728161-78728183 CGCAGCCTTTGCGATAATGCTGG + Intergenic
1160922042 19:1525544-1525566 TGCAGCCTGTGCCCCGCTGCAGG + Intronic
1163429052 19:17255924-17255946 TGCAGCCTCTGCCCCACTGCCGG - Intronic
1164552790 19:29225706-29225728 TGGAGGCTGTGCGCAAAATCAGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167646213 19:50706526-50706548 TGCAGCCTGGGAGCAAGGGCAGG - Intronic
931713463 2:65009617-65009639 TGCAGCTTGAGCGCAAAGGCTGG - Intronic
932580266 2:72988836-72988858 TGCAGCCTGTGGGCAGGTGTCGG - Intronic
935090427 2:99890622-99890644 TGCAGCCTGTGAGAGAGTGCTGG - Intronic
937472651 2:122187339-122187361 AACAGCCTGTGGGCAAAGGCAGG - Intergenic
940804517 2:158171195-158171217 TGCAGCCTCTGTGCAATTACTGG - Exonic
1169708992 20:8539982-8540004 TCCAGCCTCTGGGCTAATGCTGG - Intronic
1178818156 21:35950514-35950536 CCCAGCCTGTGGGCAAATGTTGG + Intronic
1180022125 21:45134978-45135000 TGTAGCCTGTGAGCAGATTCTGG + Intronic
1180628915 22:17213695-17213717 CGCAGCCTTTGAGAAAATGCAGG + Intronic
1182448213 22:30402191-30402213 TGCAGCCCTTTAGCAAATGCTGG - Intronic
1184831803 22:46993672-46993694 TGCAGCCTGCGGGCAGCTGCTGG + Intronic
954933791 3:54308202-54308224 TGCTGCCTGTGTTCAAATCCTGG + Intronic
960095595 3:113686623-113686645 TGCAGCATGGGGGCAACTGCTGG + Intronic
965057904 3:163745221-163745243 AACAGCCTGTGCTCAAATTCAGG - Intergenic
966726928 3:183116487-183116509 TGCAGCCAGTGCGCACGGGCAGG - Intergenic
968263439 3:197343561-197343583 TCCGGCCTGTGCGTGAATGCAGG - Intergenic
969076279 4:4580724-4580746 GGCAGCCTGAGCTCAAATCCTGG - Intergenic
970345296 4:15147326-15147348 TGCAGCCTGGGTGCATATGGCGG - Intergenic
972924460 4:43986002-43986024 TGCAGGCTGTCAGCAAGTGCAGG + Intergenic
976806120 4:89049230-89049252 TCCAGCCTGGGCGAAAAAGCAGG + Intronic
987001959 5:13668746-13668768 TGCAGACTGTGTGCAAGAGCAGG + Intergenic
998444767 5:142190009-142190031 TGCAGCATGTGTGCATGTGCGGG + Intergenic
1000059456 5:157640635-157640657 TGCAGCCCTTGTGCACATGCAGG - Intronic
1001269800 5:170302665-170302687 TGCAGCCTTTGCTCCCATGCAGG - Intergenic
1005363666 6:25056144-25056166 TGCAGCCTGTTCCCAAAGGCAGG + Intergenic
1016236920 6:141878946-141878968 TGCAGCATGTGCAAAAATACAGG + Intergenic
1016489639 6:144583248-144583270 TGCTGCCTGTGAGCATCTGCTGG + Intronic
1018982147 6:168609529-168609551 TGCAGGCTGTGCTCAGCTGCTGG + Intronic
1022299819 7:29092687-29092709 TGAAGCCTGTGCCCACCTGCAGG + Exonic
1022567090 7:31414410-31414432 GGCAGCCTGAGTTCAAATGCTGG + Intergenic
1026431307 7:70350126-70350148 AGCAGGCTGTGGCCAAATGCTGG + Intronic
1028575642 7:92347187-92347209 TGCAGCCTGTGGGCCACTGTTGG - Intronic
1028629445 7:92918657-92918679 AGCAACCTGTGAACAAATGCGGG - Intergenic
1029042720 7:97594610-97594632 GGAAGCCTGTGCATAAATGCAGG - Intergenic
1029194240 7:98793555-98793577 TGGAGCTTGATCGCAAATGCTGG - Intergenic
1033651718 7:143348830-143348852 TGCATCCCTTGCGCAAAAGCTGG + Intronic
1035785056 8:2253501-2253523 GGCACCCTGTGTGCAAATCCTGG + Intergenic
1035807755 8:2468215-2468237 GGCACCCTGTGTGCAAATCCTGG - Intergenic
1037363981 8:18103313-18103335 TACAGCCTATGCTCAGATGCAGG + Intergenic
1038682569 8:29682874-29682896 TGCAGAATGTGAGAAAATGCTGG - Intergenic
1044972018 8:97628941-97628963 TGCAGACTGTGAGCAAGTGAAGG - Intergenic
1048049765 8:130806027-130806049 TCCACCCTGTGGGGAAATGCCGG - Intronic
1048279009 8:133090951-133090973 TGCAGCCTAGGCTCAAATCCTGG + Intronic
1048613332 8:136048058-136048080 TACAGTCTGTCCGCAAATCCTGG + Intergenic
1048766409 8:137848902-137848924 TCCAGCCTGTGCGAAAGAGCAGG + Intergenic
1049431347 8:142566747-142566769 GGCACCCAGTGCCCAAATGCAGG + Intergenic
1049717435 8:144099613-144099635 TGCAGCCTGTGCCAGAATGTGGG + Exonic
1059418931 9:114179096-114179118 TTCAGCCTGGGCACAGATGCCGG - Intronic
1060176444 9:121500297-121500319 TGAAGTCAGTGCGCAAACGCGGG - Intergenic
1061956362 9:133963404-133963426 TGCAGCCTGTCCTCATAAGCTGG + Intronic
1189233407 X:39469798-39469820 TGTAGCCTTGGCCCAAATGCTGG - Intergenic
1192050893 X:67722977-67722999 TGCAGCCTGTAAGCAAACGATGG + Exonic
1192487924 X:71546784-71546806 CGCAGCCTTTGCGCTACTGCAGG - Intronic
1199993693 X:153005253-153005275 AACAGCCTATGCGCAGATGCAGG - Intergenic
1200418044 Y:2934175-2934197 TGCAGCCTGTGGGCCAGAGCCGG - Intergenic