ID: 1152171379

View in Genome Browser
Species Human (GRCh38)
Location 17:78751384-78751406
Sequence CTATTGTTCCTAAGTACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 2, 2: 4, 3: 19, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152171379_1152171381 3 Left 1152171379 17:78751384-78751406 CCTCTTGTACTTAGGAACAATAG 0: 1
1: 2
2: 4
3: 19
4: 157
Right 1152171381 17:78751410-78751432 GAAATTCAGCATTATGATTAGGG 0: 1
1: 0
2: 0
3: 31
4: 290
1152171379_1152171380 2 Left 1152171379 17:78751384-78751406 CCTCTTGTACTTAGGAACAATAG 0: 1
1: 2
2: 4
3: 19
4: 157
Right 1152171380 17:78751409-78751431 AGAAATTCAGCATTATGATTAGG 0: 1
1: 0
2: 3
3: 32
4: 365
1152171379_1152171382 4 Left 1152171379 17:78751384-78751406 CCTCTTGTACTTAGGAACAATAG 0: 1
1: 2
2: 4
3: 19
4: 157
Right 1152171382 17:78751411-78751433 AAATTCAGCATTATGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152171379 Original CRISPR CTATTGTTCCTAAGTACAAG AGG (reversed) Intronic
905756651 1:40515707-40515729 CTGTTGTACCTAAGCAAAAGAGG + Exonic
906966326 1:50460419-50460441 CTAGTGTTCCTAAGTAAAGGAGG + Intronic
908642145 1:66237079-66237101 CTTTACTGCCTAAGTACAAGTGG + Intronic
909204575 1:72738911-72738933 CTAGAGATCCTAATTACAAGGGG + Intergenic
909537933 1:76759289-76759311 CAAGTGTTTCTCAGTACAAGCGG - Intergenic
910458943 1:87427376-87427398 CTACTTTTCCTAAGTCCAAATGG + Intergenic
913446020 1:118951649-118951671 TTATTGTTCCTGATTCCAAGTGG + Intronic
914316225 1:146514278-146514300 CTACTTTTCCTAAGTCCAAATGG + Intergenic
914498130 1:148219083-148219105 CTACTTTTCCTAAGTCCAAATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922052197 1:222003310-222003332 CTAATGTTTCAAAGTATAAGAGG + Intergenic
923809510 1:237297490-237297512 CTATTGTTCCTGAGTTCTAAAGG - Intronic
1063870719 10:10414608-10414630 CTATGGTTCCTAAGCTCTAGAGG + Intergenic
1068861268 10:61850453-61850475 CTACTGATCCTAAGTCAAAGGGG - Intergenic
1074343136 10:112654011-112654033 CCATTGTTTCTAAGTACAATAGG - Intronic
1077954048 11:6994047-6994069 CTAGTGTTCCTAAGTACAAGAGG + Intergenic
1078040593 11:7858932-7858954 CTATTGTTCCTATGTCCACAGGG + Intergenic
1078832689 11:14992338-14992360 ATATTGTTCCTAATTTCCAGGGG + Intronic
1081071896 11:38621070-38621092 CTTTTGTTTATAAGTAGAAGGGG + Intergenic
1081448701 11:43153193-43153215 ATATTGTTCCTAATATCAAGTGG + Intergenic
1081448714 11:43153269-43153291 ATATTGTTCCTAATATCAAGTGG + Intergenic
1081449203 11:43156332-43156354 ATATTGTTCCTAATAACTAGTGG + Intergenic
1081449507 11:43158268-43158290 ATATTGTTCCTAATTTCTAGAGG - Intergenic
1084304934 11:68276063-68276085 CTAGTGTTCCTCAGTGCAAAAGG - Intergenic
1084453129 11:69251827-69251849 CCATTGTTCCTGAGCACAGGTGG + Intergenic
1085134775 11:74076520-74076542 CAATGGTTCCTGAATACAAGAGG - Intronic
1085998448 11:81951093-81951115 CTGTAGTTCCTAAGATCAAGTGG - Intergenic
1086432466 11:86748751-86748773 CTATTCTTCGTAAGCAGAAGGGG + Intergenic
1086444711 11:86860453-86860475 ATATTGTTCCTAATATCAAGGGG + Intronic
1092435156 12:8441562-8441584 ATATTGTCCCTAAGTTCCAGAGG + Intergenic
1093504515 12:19849595-19849617 CTAGTGTTCCTAACCACAAGGGG + Intergenic
1096114140 12:49045330-49045352 CTCTTTTTCCTAAGTGAAAGGGG - Intronic
1097433294 12:59532744-59532766 ATATTGTTCCTAATATCAAGAGG + Intergenic
1097435339 12:59547388-59547410 CTATTGTTTCTAAATCCGAGGGG + Intergenic
1098478908 12:70938943-70938965 ATATTGTTCCTAATATCAAGTGG - Intergenic
1099174162 12:79401507-79401529 CATTTGTTCCAAAGTAGAAGGGG - Intronic
1099577143 12:84395063-84395085 CTATTTTTCCTAAGAATTAGGGG - Intergenic
1102820777 12:115907576-115907598 CCATTGTTCCTATGGACAAGCGG - Intergenic
1106236865 13:27869758-27869780 CTATGGAACCTAAGTACAGGTGG + Intergenic
1108901206 13:55410730-55410752 ATATTGTTACAAAGTTCAAGTGG + Intergenic
1110259083 13:73465011-73465033 CTATTGTTCCTAATTTTAAATGG + Intergenic
1114435918 14:22707806-22707828 ATATTGTTCCTAATTTCCAGGGG - Intergenic
1116518090 14:45822963-45822985 CTATTGTTCCTAAGATGCAGGGG + Intergenic
1116518908 14:45828085-45828107 ATATTGTTCCTAAAAACCAGTGG + Intergenic
1116519225 14:45830210-45830232 ATATTGTTCCTAATATCAAGGGG + Intergenic
1117038975 14:51752894-51752916 GTATTGTTCCTAACTTCCAGAGG - Intergenic
1118998839 14:70862545-70862567 CTCTTCTTCCTGAGTTCAAGCGG + Intergenic
1120228877 14:81821308-81821330 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120228919 14:81821732-81821754 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120657136 14:87204693-87204715 CAATTGTTCCTAATTCAAAGTGG + Intergenic
1121912075 14:97800705-97800727 CTATTTTTCCTGAGGACAACTGG + Intergenic
1125011367 15:34879671-34879693 CTATTGTTACCAAGCAAAAGGGG - Intronic
1125489090 15:40133309-40133331 ATATTGTTCCTAATAACTAGTGG + Intergenic
1127310335 15:57746566-57746588 CTATTGCTTTTAAGTAGAAGGGG + Intronic
1129815593 15:78550462-78550484 GTGTTGTTCCTAAGCATAAGAGG - Exonic
1129815613 15:78550611-78550633 TTAATGTTCCTAAGCACAAGAGG - Exonic
1131354091 15:91729094-91729116 CTTTTGTACCTAAGTTCATGAGG + Intergenic
1135300624 16:21323739-21323761 CTCATGTTCCTAAGTGCAAAAGG + Intergenic
1136557976 16:31019870-31019892 CTTTTGTTCCTGAGCACAACAGG + Intergenic
1143004403 17:3819117-3819139 CTAGTGTTCCTAGATGCAAGGGG + Intronic
1145932691 17:28697401-28697423 CTGTTGTTCCCAAGCACTAGGGG + Intronic
1151053883 17:71010019-71010041 CTGTTGCTCCTAAGTACATTTGG - Intergenic
1152098789 17:78288767-78288789 CTATTGTTAAGAGGTACAAGGGG + Intergenic
1152171379 17:78751384-78751406 CTATTGTTCCTAAGTACAAGAGG - Intronic
1155542966 18:26886307-26886329 ATATTGTTCCTAAATTCAAGGGG - Intergenic
1156732298 18:40208851-40208873 TAATTGTTCCTAATTGCAAGTGG + Intergenic
1160470018 18:79123013-79123035 CCCTTGTTCCTAAGTTTAAGGGG - Intronic
1163853046 19:19677306-19677328 CTTTTGTTCCAAACTAGAAGTGG - Intronic
1166237723 19:41468694-41468716 ATATTGTTCCTAATATCAAGGGG - Intergenic
1166245841 19:41525041-41525063 ATATTGTTCCTAATATCAAGGGG - Intergenic
926758544 2:16255346-16255368 CTACTATTTCTAAGCACAAGGGG - Intergenic
930968919 2:57369959-57369981 CTAATGTTCATACTTACAAGTGG - Intergenic
931599500 2:63989569-63989591 CTTTTTTTCCTAAGTGCACGTGG + Intronic
931838787 2:66127627-66127649 CTCATGTTCCAAAGTACAAAGGG - Intergenic
933402526 2:81817280-81817302 CTATTGATCCTAAGATGAAGAGG + Intergenic
934507163 2:94903696-94903718 ATATTGTTCCTAATATCAAGTGG + Intergenic
945488533 2:210426979-210427001 CTTTTTTTCCTAAGTGCATGTGG - Intergenic
946932730 2:224687040-224687062 CTAGTGTTTCTAAGTGCAAGAGG + Intergenic
947232192 2:227899796-227899818 ATCTTGTTCCTAAGTTCCAGGGG - Intronic
947761771 2:232608574-232608596 CTCTTTTTCCCAAGTACAATTGG - Intronic
1169821191 20:9712093-9712115 CTCATGTTCCTAAGCACAATAGG - Intronic
1170138153 20:13098605-13098627 CTATTTTTCATGAGTACAAAGGG - Intronic
1172438547 20:34948389-34948411 CTATTGATCCTAAATTCAGGAGG - Intronic
1172913699 20:38428655-38428677 CAACTGTTACTAAGTTCAAGAGG + Intergenic
1176607117 21:8842624-8842646 ATATTGTTCCTAATAGCAAGTGG - Intergenic
1177689424 21:24485388-24485410 GTAATGTTCCTAAGTGCAAAAGG - Intergenic
1178010571 21:28281178-28281200 CTAGTGTTTCTAAGTGCAAAAGG - Intergenic
1180357197 22:11852412-11852434 ATATTGTTCCTAATATCAAGTGG - Intergenic
1180381065 22:12139919-12139941 ATATTGTTCCTAATATCAAGTGG + Intergenic
1182812297 22:33127305-33127327 CTTCTCTTCCTAAGCACAAGTGG + Intergenic
949745518 3:7287534-7287556 CTATGCTTCTTAAGTACAACAGG - Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
953751645 3:45613105-45613127 CTAGTGTTCCTAAGAGCAAGAGG + Intronic
955206660 3:56901981-56902003 CTAGTATTTCTAAGCACAAGAGG - Intronic
957540834 3:81566827-81566849 CTGTAGTTCCAAAGCACAAGTGG - Intronic
957835939 3:85589312-85589334 CTATTGTGCCTAAGTAATTGAGG - Intronic
962323442 3:134410592-134410614 CTAGTGTTCCTGTGTGCAAGAGG + Intergenic
962395860 3:135014975-135014997 CTTTTGTTCCTAAAGACAGGGGG - Intronic
964430687 3:156603449-156603471 CTTTGGTTGCCAAGTACAAGAGG + Intergenic
964889030 3:161516320-161516342 ATATTGTTCCTAATATCAAGGGG - Intergenic
965399798 3:168201634-168201656 ATATTGTTCCTAATTTCCAGGGG - Intergenic
967634246 3:191782045-191782067 CTAGTGTTTCTAAACACAAGAGG + Intergenic
971680609 4:29694636-29694658 ATATTGCTCTTAAGTGCAAGTGG - Intergenic
972854161 4:43086199-43086221 CTAGCATTCCTAAGAACAAGAGG - Intergenic
973371003 4:49248590-49248612 ATATTGTTCCTAACAGCAAGTGG + Intergenic
973390023 4:49546865-49546887 ATATTGTTCCTAATAGCAAGTGG - Intergenic
974812493 4:66962866-66962888 CCATTGTTCCTAAGGAGAATAGG + Intergenic
975940295 4:79635919-79635941 CTATGTTTGCTAAGTAAAAGTGG - Intergenic
977403887 4:96571115-96571137 GTATTGTTCCTAAGTAGCACAGG - Intergenic
981229391 4:142335499-142335521 CTTTGCTTCCTAAGTACCAGAGG + Intronic
983974656 4:173918781-173918803 TTATTGTCCCTGAGTACAAGAGG + Intergenic
984331758 4:178329747-178329769 CTATTGTGGAAAAGTACAAGTGG + Intergenic
987204540 5:15611394-15611416 ATAGTGTTCCTAAGTGCAAGAGG + Intronic
989527757 5:42473028-42473050 CTACTGTTTCTAAGTGAAAGAGG + Intronic
991347273 5:65683126-65683148 CTAGTATTCCTAAGTGCAAGAGG - Intronic
991455016 5:66793628-66793650 CTATTACTCCCAAGTACAAATGG - Intronic
993980683 5:94540038-94540060 CCATTGTTCAAAAGTTCAAGTGG - Intronic
994395178 5:99221222-99221244 ATATTGTTCCTAATTCCAAGGGG - Intergenic
995418844 5:111939764-111939786 CTAGTGTTCCTGAGCACAAGAGG + Intronic
997430168 5:133832308-133832330 CTAGTTCTCCTGAGTACAAGGGG - Intergenic
998936289 5:147233983-147234005 ATATTGTTCCTAATAACTAGTGG + Intergenic
1003197057 6:3924727-3924749 CTAGTGTCCCTAAGTGCAAGAGG - Intergenic
1009046380 6:58241327-58241349 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009046439 6:58241705-58241727 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009222199 6:60995644-60995666 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009222259 6:60996022-60996044 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009362765 6:62835573-62835595 ATATTGTTCCTAATTTCCAGAGG + Intergenic
1009363051 6:62837644-62837666 ATATTGTTCCTAATAACCAGGGG + Intergenic
1009364001 6:62844111-62844133 ATATTGTTCCTAAATTCCAGGGG + Intergenic
1009364890 6:62850318-62850340 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009368039 6:62870887-62870909 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009368712 6:62876239-62876261 ATATTGTTCCTAATATCAAGGGG + Intergenic
1009369054 6:62878811-62878833 ATATTGTTCCTAACTTCCAGGGG + Intergenic
1009736119 6:67677422-67677444 CTTTTCTACCTAAATACAAGAGG - Intergenic
1011346355 6:86373267-86373289 ATATTCTTCCCAAGTACATGTGG - Intergenic
1018118367 6:160611064-160611086 CTCTTGGTCCTAAGTACCAGTGG - Intronic
1018118961 6:160616619-160616641 CACTCGTTCCTAAGTACCAGTGG - Intronic
1018119565 6:160622165-160622187 CACTCGTTCCTAAGTACCAGTGG - Intronic
1018120165 6:160627709-160627731 CACTCGTTCCTAAGTACCAGTGG - Intronic
1018120770 6:160633255-160633277 CACTCGTTCCTAAGTACCAGTGG - Intronic
1018121363 6:160638802-160638824 CACTCGTTCCTAAGTACCAGTGG - Intronic
1018121965 6:160644349-160644371 CACTCGTTCCTAAGTACCAGTGG - Intronic
1023269313 7:38444020-38444042 CTATTGTCTATAAGTACAACTGG - Intronic
1023478648 7:40608716-40608738 CTATTGTACTAAAGTACAAAAGG - Intronic
1028112008 7:86951919-86951941 CTAGTGTTCCTAAGTACAAGAGG - Intronic
1029301682 7:99586435-99586457 ATATTGTTCCTAATATCAAGGGG - Intronic
1029342706 7:99957876-99957898 ATATTGTTCCTAATACCAAGTGG + Intergenic
1033005994 7:137563327-137563349 GTATTGTTCCTGATTACATGGGG - Intronic
1038980432 8:32753566-32753588 AACTTGTTCCTAAGTACAATTGG + Intronic
1041115851 8:54535876-54535898 CTAATGTTCCTAAGCACAAGAGG - Intergenic
1041244439 8:55877189-55877211 CTGTTGTTGCTAAGCACCAGAGG - Intergenic
1041479391 8:58300877-58300899 CTAGTGTTCCTAAGCACAAGAGG - Intergenic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1042209487 8:66365474-66365496 GTAGTGTTCCTAAGTGCAAGGGG + Intergenic
1042567558 8:70127966-70127988 CTAGTGTTCCTAAGTGCAAGAGG + Intronic
1042999609 8:74741753-74741775 TTAGTGTTCCTAAGTGCAAGAGG - Intronic
1043359139 8:79450345-79450367 CTATTGTTCCTGTTTAAAAGAGG - Intergenic
1043628485 8:82294929-82294951 TTAGTGTTCCTAAGCACAAGAGG - Intergenic
1044484877 8:92740416-92740438 CTCTCATTCCTAAGTATAAGAGG - Intergenic
1045449121 8:102302583-102302605 CAATAGTTCCTGAGTACAAAGGG - Intronic
1045925272 8:107574574-107574596 CTATTGTTCCTAAAATCCAGTGG + Intergenic
1047906308 8:129476716-129476738 CTATTTTTCCTAATTAAAATAGG + Intergenic
1048666890 8:136672403-136672425 CTAGTGTTTCTAATTTCAAGAGG + Intergenic
1049029263 8:140022277-140022299 CTGTTATTCCTAAGTCTAAGTGG - Intronic
1051026515 9:12619233-12619255 CTAGTGTTCCTAAGCTCAAAAGG - Intergenic
1051900719 9:22036298-22036320 CTATTGGTCCTAAGCACTACTGG - Intergenic
1057816002 9:98295391-98295413 CTAGTGTCCCTAAGCACAAGAGG + Intronic
1059914311 9:119082011-119082033 CTCTTGTTCCTCAATAAAAGTGG - Intergenic
1059964918 9:119604156-119604178 CTTTTGTTTAAAAGTACAAGGGG - Intergenic
1203695409 Un_GL000214v1:93389-93411 ATATTGTTCCTAATATCAAGTGG + Intergenic
1203742259 Un_GL000218v1:12926-12948 ATATTGTTCCTAATATCAAGTGG - Intergenic
1203702450 Un_KI270742v1:7515-7537 ATATTGTTCCTAATATCAAGTGG - Intergenic
1203554430 Un_KI270743v1:193571-193593 ATATTGTTCCTAATAGCAAGTGG - Intergenic
1203640864 Un_KI270751v1:10674-10696 ATATTGTTCCTAATATCAAGTGG - Intergenic
1186266192 X:7836502-7836524 CTATTGTTGCAAAGTAAATGTGG + Intergenic
1189365746 X:40387222-40387244 CTAGTGTTCCTAGGTGCAACGGG - Intergenic
1193283989 X:79690157-79690179 TTATTCTTCCTAACTTCAAGTGG - Intergenic
1193648792 X:84103795-84103817 CTATTTTTACTAATTATAAGAGG + Intronic
1193932143 X:87566338-87566360 CAATTGTTCCTAAAAACAAATGG + Intronic
1197523288 X:127526575-127526597 ATATTCTTCTTAAGTACATGTGG + Intergenic
1198799722 X:140436502-140436524 TTACTGTTTCAAAGTACAAGTGG + Intergenic
1199893500 X:152111246-152111268 CTACTCTTCCTAACTGCAAGTGG + Intergenic
1201155794 Y:11130401-11130423 ATATTGTTCCTAATATCAAGTGG - Intergenic