ID: 1152171740 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:78755081-78755103 |
| Sequence | GTATGGCTGCACCACGTTTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 46} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152171740_1152171743 | 5 | Left | 1152171740 | 17:78755081-78755103 | CCAAAAACGTGGTGCAGCCATAC | 0: 1 1: 0 2: 0 3: 4 4: 46 |
||
| Right | 1152171743 | 17:78755109-78755131 | AACATTACTCAGCAATGAAAAGG | 0: 2 1: 25 2: 235 3: 1168 4: 4357 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152171740 | Original CRISPR | GTATGGCTGCACCACGTTTT TGG (reversed) | Intronic | ||