ID: 1152171740

View in Genome Browser
Species Human (GRCh38)
Location 17:78755081-78755103
Sequence GTATGGCTGCACCACGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152171740_1152171743 5 Left 1152171740 17:78755081-78755103 CCAAAAACGTGGTGCAGCCATAC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1152171743 17:78755109-78755131 AACATTACTCAGCAATGAAAAGG 0: 2
1: 25
2: 235
3: 1168
4: 4357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152171740 Original CRISPR GTATGGCTGCACCACGTTTT TGG (reversed) Intronic