ID: 1152174995

View in Genome Browser
Species Human (GRCh38)
Location 17:78781845-78781867
Sequence CAGGATCTCAGGGGCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 18, 3: 26, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152174995_1152175008 17 Left 1152174995 17:78781845-78781867 CCCTCAGAGCCCCTGAGATCCTG 0: 1
1: 0
2: 18
3: 26
4: 281
Right 1152175008 17:78781885-78781907 CCCTCATTCCTCAGAGCTCGCGG 0: 1
1: 0
2: 0
3: 12
4: 171
1152174995_1152175011 27 Left 1152174995 17:78781845-78781867 CCCTCAGAGCCCCTGAGATCCTG 0: 1
1: 0
2: 18
3: 26
4: 281
Right 1152175011 17:78781895-78781917 TCAGAGCTCGCGGCGACCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152174995 Original CRISPR CAGGATCTCAGGGGCTCTGA GGG (reversed) Intronic
900371157 1:2332828-2332850 CAGGACCCCAGGGTCTCAGAGGG + Intronic
900545209 1:3224911-3224933 CAGCATCTCAGGGACTCTGGCGG + Intronic
900553119 1:3266437-3266459 CAGTCTCTCTGGGGCTCTCAGGG - Intronic
900570412 1:3355488-3355510 CTAGGTCTCAGGGGCTCTGCTGG + Intronic
901724383 1:11229371-11229393 AAGGACCTCAAGGACTCTGACGG + Intronic
902402467 1:16165776-16165798 CCAGGTCTCAGGGGCTCTGTAGG + Intergenic
903233585 1:21936236-21936258 CAGGTCCTCAGGGCCTCTGCTGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906723280 1:48024779-48024801 CAGGATCTCAGAGGCTGTGAGGG - Intergenic
907307142 1:53519730-53519752 CAGAGTCCCAGGGGCTCTGGGGG + Intronic
907712100 1:56892846-56892868 AAGAATCTCAGGGAGTCTGATGG + Intronic
907824094 1:57998913-57998935 CAGGATCTCAGGTGCAATGCTGG + Intronic
908923721 1:69227268-69227290 CAGCATCTCAAGGGCTCTGTAGG - Intergenic
912126434 1:106544654-106544676 CAGATTCTCATGGGCTCTGGTGG - Intergenic
912510214 1:110184621-110184643 CAGGAGCTCTGGGACTCTGTGGG + Intronic
913673170 1:121116955-121116977 CTGGATCTCACGGGATGTGATGG + Intergenic
915283074 1:154836006-154836028 CAGGATCTGAGGGCGTCTGGAGG + Intronic
915484490 1:156210737-156210759 CAGGGTCTCAGGGACACAGATGG - Exonic
916656807 1:166884126-166884148 CAGGAACTCACCGGCTCTGGCGG + Intergenic
917270197 1:173264235-173264257 GAGGATCTCTGGGGCTCAGGAGG - Intergenic
918634339 1:186756699-186756721 CAAGATCTCAGGGTCACAGATGG + Intergenic
920077021 1:203344642-203344664 CAGGAGCTCAGGGGCGCACAGGG - Intronic
922157334 1:223050816-223050838 GAGGATCTCATGAGCTCAGAAGG - Intergenic
1063083988 10:2798065-2798087 CAGGAGCTCAGGGGAGCTGGGGG + Intergenic
1067894505 10:50164431-50164453 CAGGTTTCCAGGAGCTCTGAAGG - Intergenic
1067954338 10:50775830-50775852 CAGGTTTCCAGGAGCTCTGAAGG + Intronic
1069434854 10:68371615-68371637 CACGGTATCAGAGGCTCTGAAGG + Intronic
1074426253 10:113354025-113354047 CAGCAAGTCAGGGGGTCTGATGG + Intergenic
1076542097 10:131220822-131220844 CAGCACCTCGGGGGCTCCGAGGG + Intronic
1076688984 10:132211278-132211300 CAGGATCCCAGCGGCTCAGTCGG - Intronic
1077106426 11:844421-844443 CCAGATCTCAGGGGCTCTGCTGG - Intronic
1077491302 11:2862241-2862263 CAGGGTCCCAGGGGCTCTCCTGG + Intergenic
1078359236 11:10655634-10655656 CAGGATTTCAGGGACTCCCAGGG - Intronic
1078668716 11:13346614-13346636 AAGGATCTCAGGGGCTCCACAGG - Intronic
1078791558 11:14547691-14547713 GAGGAGCTCAGAGGCTCTGTGGG + Intronic
1080429891 11:32188689-32188711 CAGGGTCTCTAGGGTTCTGAGGG - Intergenic
1080783633 11:35454418-35454440 CCTGATCTCATGGGCTCTGAGGG - Intronic
1081573010 11:44303138-44303160 CTGGCTCTCCAGGGCTCTGAAGG - Intronic
1083021768 11:59515136-59515158 CAGGACCTTAGGAGCTGTGATGG - Exonic
1083665819 11:64274008-64274030 CAGGTCCTCAGGTCCTCTGAGGG - Intronic
1084155486 11:67310605-67310627 CTGGATCTCAGCTGCTCTCAGGG - Intronic
1085328601 11:75628028-75628050 CCGGATCTCAGGGGCTGTGCTGG + Intronic
1085385757 11:76157318-76157340 CAGAAGAACAGGGGCTCTGAAGG - Intergenic
1089155437 11:116398582-116398604 CAGGAGCTCACCAGCTCTGAGGG - Intergenic
1089201642 11:116728085-116728107 CAGCATCTCAGTGACTGTGAGGG - Intergenic
1089216392 11:116837098-116837120 CTCGATCCCAGGGGCTCTGGGGG + Exonic
1089609840 11:119663127-119663149 CAGGGTGTCAGGGGCTCTGCAGG - Exonic
1089613275 11:119681421-119681443 CAGGATTGCAGGGGCTCAGAGGG - Intronic
1090409080 11:126495329-126495351 GAGGATCTCTGGGGCTCAGAGGG - Intronic
1091541288 12:1465037-1465059 CAGGAGCTCAGGGACTCAGGAGG - Intronic
1091625681 12:2119156-2119178 CAGGCTCTCTGGGCCTCAGAGGG + Intronic
1093066203 12:14661049-14661071 CAGGATCTGAGGGCCTGTGGCGG + Exonic
1093125309 12:15322214-15322236 CTGGGTCTCAGGAGTTCTGAGGG - Intronic
1093288273 12:17293436-17293458 CGAGATCTCATGAGCTCTGATGG - Intergenic
1094201075 12:27795006-27795028 CAGGAGTTCAGGGGGACTGAGGG - Intronic
1095175212 12:39084391-39084413 GTGGATCTCATGGGATCTGATGG - Intergenic
1096386955 12:51200404-51200426 CAGGATCACAGGGGCTCTCCAGG + Intronic
1096685932 12:53288302-53288324 GAGATCCTCAGGGGCTCTGACGG + Exonic
1099798835 12:87432031-87432053 CATGTTCTCAGGACCTCTGAGGG - Intergenic
1101365329 12:104064905-104064927 CAGGATCTCCGGGGCCCTTGGGG + Intronic
1102282135 12:111626780-111626802 CATGAGCTCAGGGGCCATGAGGG + Intergenic
1102920071 12:116785134-116785156 GAGCATCTCTGGGGGTCTGAAGG - Intronic
1103888000 12:124217174-124217196 CAGAATCCCAGGGGAGCTGATGG + Intronic
1104968935 12:132522446-132522468 CAGGAGCACTGGGGCCCTGAGGG - Intronic
1105211310 13:18258658-18258680 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1105215176 13:18279974-18279996 CACCATCACAGGGCCTCTGAGGG + Intergenic
1105781647 13:23709783-23709805 CTAGATCTCTGGGGCTGTGATGG + Intergenic
1108225213 13:48282364-48282386 AAGGATCTCAGGGAATCTCAGGG - Intergenic
1110514848 13:76397931-76397953 AAGGATCTCAAGAGCTGTGAAGG + Intergenic
1112052964 13:95662382-95662404 AAGGGTCTCAGGAGATCTGATGG + Intergenic
1113112341 13:106837105-106837127 CAGAATGTCAAGAGCTCTGAGGG - Intergenic
1116405735 14:44563880-44563902 AAGGATCTCAGTGGGTCTGAAGG + Intergenic
1117965995 14:61207149-61207171 CAGAATCTCATGGGCCCTTAGGG - Intronic
1119348032 14:73942389-73942411 CAGCATCACAGGGCCGCTGAGGG + Exonic
1119567404 14:75640549-75640571 CAGGATCTCCGTGGCTCTCTGGG - Intronic
1119656865 14:76423529-76423551 CTGGACCCCAGGGGCTCTGTGGG + Intronic
1119667610 14:76496512-76496534 CAGAAGCTCAAGGGCTGTGAAGG + Intronic
1121438542 14:93934498-93934520 CAGGATCTCACTGGGTCTCAGGG - Exonic
1121960294 14:98253434-98253456 CAGCATGAGAGGGGCTCTGAAGG + Intergenic
1122878212 14:104678496-104678518 GAGGATCTCTGGGGCTCCCAGGG - Intergenic
1124482017 15:30087126-30087148 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124488475 15:30139226-30139248 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124521573 15:30410077-30410099 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124537088 15:30556142-30556164 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124543562 15:30608198-30608220 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1124755054 15:32399096-32399118 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124761561 15:32451449-32451471 CAGGTTATCAGGGGCCCTGTGGG + Intronic
1124777070 15:32597619-32597641 CAGGTTATCAGGGGCCCTGTGGG - Intronic
1125441946 15:39712277-39712299 CACACTCTCAGGGGCTCTGAAGG + Intronic
1128228602 15:66019541-66019563 CAGGAACCCAGCAGCTCTGAGGG + Intronic
1128711640 15:69876558-69876580 CAGGCTCTCAGGGGCTCAGGAGG - Intergenic
1128764039 15:70240116-70240138 CACCATCTCAGGGACTCTGGGGG + Intergenic
1128800045 15:70491611-70491633 CTGGAACTCAGGGGTCCTGATGG - Intergenic
1128838786 15:70832700-70832722 CATGAACTCATGGGCTTTGATGG + Exonic
1129521540 15:76189567-76189589 CAGACTCTCAGGGGTTCCGAGGG - Intronic
1129596458 15:76968045-76968067 CAGAATCCCAGTGGCTCTGTGGG - Intergenic
1129803355 15:78433926-78433948 CAGGAACTCAGGGGCTGAGGTGG + Intergenic
1131259036 15:90879106-90879128 CATGAACTCTGGGGCTCTGTAGG + Intronic
1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG + Intronic
1134470860 16:14524765-14524787 CAGGATCCGAGTGGCACTGATGG - Intronic
1134801562 16:17089658-17089680 CAGGCCCTCAGGGGCTATAAAGG - Intergenic
1135385773 16:22038127-22038149 AGGGATCTCAGGGGCTGTGTTGG + Intronic
1135975074 16:27103386-27103408 CAGGAATGCAGAGGCTCTGAGGG + Intergenic
1136022628 16:27449695-27449717 CAGCATCTCCGGGGCTTTGTGGG + Exonic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1141039050 16:80655815-80655837 CAGAGTCTGAGGGGCTCTGGAGG - Intronic
1141041997 16:80680843-80680865 CAGGATCTCAGGGGGCTGGAGGG - Intronic
1141301798 16:82822889-82822911 GTGGATCTCAGGGTTTCTGATGG + Intronic
1141806569 16:86345716-86345738 GAGGATTTCAGAGGGTCTGAGGG - Intergenic
1141869403 16:86774320-86774342 CAGGCCCTCAGGGGATCGGATGG + Intergenic
1142123282 16:88397479-88397501 CAGGATCTCAGGGGGTTAAAGGG + Intergenic
1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG + Intergenic
1142360867 16:89626096-89626118 AAGAATCTCAGGGCCTCTCAGGG - Intronic
1143908258 17:10226954-10226976 CAGGAACTCAGTCGCTCTGCAGG - Intergenic
1144170286 17:12653395-12653417 CAGCATCTCAGGGGTTCTGATGG + Intergenic
1144630944 17:16872161-16872183 CAGGATCTCAGGAGCTCAAGAGG - Intergenic
1144829187 17:18122078-18122100 CAGGGGCTCTGGGGCCCTGATGG - Exonic
1145250385 17:21293980-21294002 CAGTACCTCAGGACCTCTGATGG + Intronic
1145357074 17:22168579-22168601 CAGGGTCTCTGGGCCTATGATGG + Intergenic
1145786118 17:27594946-27594968 CAGGATCACAGAGGGACTGATGG + Intronic
1147867113 17:43560343-43560365 CAGGAACTCAGAGCCTCTGTGGG - Intronic
1148159931 17:45444043-45444065 CAGGTCCCCAGGGGCTCTCAAGG - Intronic
1150379578 17:64709927-64709949 CGAGATCTCAGGAGGTCTGAGGG + Intergenic
1150391218 17:64790922-64790944 CAGGTCCCCAGGGGCTCTCAAGG - Intergenic
1150410004 17:64934965-64934987 CAGGTCCCCAGGGGCTCTCAAGG - Intergenic
1150649698 17:67001727-67001749 CAGGACTTCAGGGGCCCTCATGG + Intronic
1151340549 17:73468060-73468082 CTGGAGCTCTGGGGCTTTGAGGG + Intronic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1203169672 17_GL000205v2_random:136213-136235 ATGGATCTCAGGGGCTCATAGGG - Intergenic
1154038722 18:10833010-10833032 CAGGATCCTGGAGGCTCTGAGGG + Intronic
1154442940 18:14409020-14409042 CAGGCCCTCTGGGGCTCTGGGGG + Intergenic
1155035354 18:22020950-22020972 CAGGAGGCCAGGGGCTCTGCAGG + Intergenic
1159305121 18:66630863-66630885 CAGAATGTCAGGGGCCATGATGG + Intergenic
1160662870 19:309155-309177 CAGGAGCTGGAGGGCTCTGAGGG - Intronic
1160694778 19:478209-478231 CAGGACCCCAGGGGCTCCCACGG + Intergenic
1161778850 19:6278685-6278707 CAGGATCCCAGGGGCGGAGAGGG + Intronic
1161984649 19:7646791-7646813 CTGGACTTCTGGGGCTCTGAGGG + Intronic
1161995250 19:7707708-7707730 CAGGATTTCAGAGTCTCTGAGGG - Intergenic
1162373879 19:10294009-10294031 CAGGATTGCAGGGGCTCACACGG - Intronic
1164415667 19:28044937-28044959 CATGATCCCAGGTGCTCAGAAGG + Intergenic
1164476556 19:28579941-28579963 CAGGCTCTCAGTGGTTCTCAGGG - Intergenic
1165398132 19:35578663-35578685 CTGGATCTCAGGGGTCCTGGTGG - Intergenic
1165433294 19:35784323-35784345 CAGGACCTCAGGGGGTGGGAGGG - Intronic
1165857782 19:38890207-38890229 AACGATGTCAGGGGCTGTGATGG - Intronic
1166202666 19:41248637-41248659 CAGGATCTCAGAAGTTCAGAAGG - Intronic
1166253917 19:41589151-41589173 CAGCTTCTCAGGGGCTCAGCTGG - Intronic
1166276571 19:41758199-41758221 CAGGATTTCAGGTGCAGTGAGGG - Intronic
1166980898 19:46631486-46631508 TAGGATCCCAGGACCTCTGAGGG - Intergenic
1166989326 19:46681743-46681765 CAGGATCTGAGGGGAGCAGATGG + Exonic
1167422829 19:49414085-49414107 CAGCATTTCAGGGACTCAGATGG + Intronic
925277901 2:2663433-2663455 CGGGACCTCAGGGGCTGAGAAGG + Intergenic
927337391 2:21941049-21941071 CAGGATCTCTGGGAAACTGAGGG - Intergenic
928328292 2:30337372-30337394 CTGCAGCTCAGGGGCACTGAGGG - Intergenic
929990356 2:46781305-46781327 CAGGCTTTAAGAGGCTCTGATGG - Intergenic
931218258 2:60265768-60265790 CAGGATCTCAGGGGTCCTGGGGG - Intergenic
931759734 2:65406188-65406210 CAGGGTCTTTGTGGCTCTGAAGG - Intronic
931882168 2:66578647-66578669 CAGGAGCCCAGGGGCTCCGGGGG - Intergenic
933059148 2:77713845-77713867 CATGTTCTCAGGGTCTCTGAAGG + Intergenic
933739723 2:85524003-85524025 CAGGATCTGAGGGCTTCTAAAGG + Intergenic
933844584 2:86315074-86315096 CAGGGTCTCAAGGGCCCTGCAGG - Intronic
934299144 2:91766763-91766785 CACCATCACAGGGCCTCTGAGGG - Intergenic
935212004 2:100946325-100946347 GATGATTTAAGGGGCTCTGAGGG - Intronic
935336346 2:102020837-102020859 CAGGATCTCAGTGGCTCTCAAGG + Intronic
935385836 2:102499216-102499238 AGAGATCTGAGGGGCTCTGATGG + Intronic
935719955 2:105971309-105971331 CAGGATTTCAGGGGTTCCCAAGG - Intergenic
938315029 2:130319184-130319206 CAGGATCCCCGAGGCTCAGATGG + Intergenic
940102764 2:150060839-150060861 CAGGATCCCATTGGCCCTGATGG + Intergenic
941974489 2:171387873-171387895 CAGCATCTCTGGGGCTAGGAAGG - Intronic
944376381 2:199048794-199048816 CAGGATCTCTTGGGCCCAGAAGG - Intergenic
945247105 2:207728743-207728765 CAGGATCTCAGGGATACAGAAGG - Intronic
946190856 2:218007219-218007241 CAGAATCTGAGGGGCTGAGAGGG - Intergenic
946229708 2:218283606-218283628 GAGGCTCTCAGAGGCTCTGCTGG + Intronic
946265986 2:218541849-218541871 AAGGATCTTAGAGACTCTGATGG - Intronic
947768266 2:232651207-232651229 CAGGAGCTCTGGGGCTGGGAAGG + Intronic
948596434 2:239082410-239082432 CAGGGTCGCAGGGGTTCTAAGGG + Intronic
1170666754 20:18393245-18393267 CAGCAACACAGGGGATCTGAAGG + Intronic
1172008616 20:31833761-31833783 CAGCAGCTCGGGGGCACTGATGG + Exonic
1174857724 20:54063076-54063098 CAGGACCTTTGGGGCACTGAAGG - Intronic
1175503426 20:59466200-59466222 CAGGAGCGCAGGGGCTCGGATGG - Intergenic
1175924493 20:62465249-62465271 GAGGCTCCGAGGGGCTCTGATGG + Intronic
1175936294 20:62515637-62515659 CTGCATCTCAGAGGCTCTGAGGG + Intergenic
1176033976 20:63027452-63027474 CAGGATCTCAGGGCACCTGCTGG + Intergenic
1176402083 21:6322936-6322958 ATGGATCTCAGGGGCTCATAGGG + Intergenic
1176435074 21:6666168-6666190 ATGGATCTCAGGGGCTCATAGGG - Intergenic
1176459336 21:6993238-6993260 ATGGATCTCAGGGGCTCATAGGG - Intergenic
1176695866 21:9977482-9977504 ATGGATCTCAGGAGATCTGATGG + Intergenic
1178099199 21:29248534-29248556 CATGATTTCAGGAGCTCAGATGG - Intronic
1178109793 21:29358368-29358390 CAGGAACTCAGGGACTTTGGAGG + Intronic
1178581614 21:33843233-33843255 CAGGAGCTCTGGGGCTATTATGG - Intronic
1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG + Intronic
1180163673 21:46009284-46009306 CAGGGACCCAGGGGGTCTGAGGG + Intergenic
1180764925 22:18340779-18340801 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1180814106 22:18778905-18778927 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1181031880 22:20152286-20152308 CAGGGACTCAGGGGCAGTGAGGG - Intergenic
1181200289 22:21213240-21213262 GAGGCTCTGAGGGGCTCAGAGGG + Intronic
1181457286 22:23066970-23066992 CAGGGTCCTAGGGGCTCTGGAGG + Intronic
1181701449 22:24623719-24623741 GAGGCTCTGAGGGGCTCAGAGGG - Intronic
1181760760 22:25057295-25057317 CTGGAGCTCCGGGGCTCTGTGGG + Intronic
1181960917 22:26621304-26621326 CTGGAGCTCAGGGGACCTGAAGG - Intergenic
1182557228 22:31135805-31135827 GGGCCTCTCAGGGGCTCTGAAGG + Exonic
1183234109 22:36603816-36603838 CTGGTTCTCAAGAGCTCTGATGG + Intronic
1183546930 22:38459335-38459357 CAGGCTCTCAGGGCCCCTGTAGG - Intergenic
1184679398 22:46062012-46062034 CAGGCCCGCAGCGGCTCTGAAGG - Intronic
1185296249 22:50056763-50056785 CAGGAAATCAGGGACTCTGGGGG - Intronic
1203226547 22_KI270731v1_random:81684-81706 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1203264203 22_KI270734v1_random:4592-4614 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG + Intronic
950017020 3:9761523-9761545 CAGGACTTCAGGGGCTGTGGAGG + Exonic
950404943 3:12798387-12798409 CAGGAGCTCAGGGTCTCCCAGGG - Intronic
950835967 3:15919218-15919240 CAGGATTTCAGAGGCTATTAGGG + Intergenic
950965724 3:17144408-17144430 CATGGTCCCAGGGTCTCTGATGG + Intergenic
953262416 3:41352691-41352713 GAGGATCTCAGCTGCTCTGCTGG - Intronic
953877428 3:46674235-46674257 AGGGACTTCAGGGGCTCTGAGGG + Intronic
954464299 3:50645701-50645723 CAGGACCTCAGGGGCTGCCAGGG - Exonic
959670621 3:108973205-108973227 CAGGCTCTGTGGGGCACTGAAGG - Intronic
960949437 3:122989521-122989543 AAGGGCCTCTGGGGCTCTGAAGG + Intronic
961697402 3:128715054-128715076 CAGGTTCTCAGGTTCTCTCAAGG + Intergenic
962345957 3:134619204-134619226 CAGGATGTCAGTGGGTTTGAAGG + Exonic
963051499 3:141147494-141147516 CAGGCTCTCTGTGGCTCCGAAGG - Exonic
963617334 3:147558289-147558311 AAGGATCTCAGGGACGCTTACGG + Intergenic
964658438 3:159093827-159093849 CAAGTTCTCAGGAGATCTGATGG - Intronic
965482464 3:169236061-169236083 CATGATCACAAGGGCACTGATGG + Intronic
966242397 3:177768974-177768996 CAAGATCTCTGGGTCTGTGATGG + Intergenic
966642741 3:182208664-182208686 TGGGATCTCTGGGGCTATGATGG + Intergenic
968752190 4:2396023-2396045 CAGGATTTAAGGGGAGCTGATGG + Intronic
970174414 4:13324343-13324365 CAGGAGCAGTGGGGCTCTGAAGG - Intergenic
970492603 4:16590129-16590151 CGGCTTCTCAGGGGCTCTGCTGG + Intronic
971994821 4:33952008-33952030 TAAAATCTCATGGGCTCTGATGG + Intergenic
978954708 4:114599221-114599243 CAGGATCGCGGGCGCTATGAGGG - Intronic
981763435 4:148219456-148219478 CAGGGTCTCAGGGACTGTTATGG + Intronic
982666301 4:158268820-158268842 CAGGATCTCTTTGGCTCTGATGG - Intergenic
983278809 4:165654182-165654204 CATGATCACAGGGTCTCTGTGGG - Intergenic
983511064 4:168610242-168610264 CAGGAGAACAGGAGCTCTGAGGG - Intronic
986483108 5:8209405-8209427 GAGTGTCTCTGGGGCTCTGAAGG + Intergenic
987366258 5:17151794-17151816 CAGGACCTCAGGAGCTCTGAAGG + Intronic
987788393 5:22532035-22532057 CGATATCTCAGGGGCTTTGAGGG + Intronic
990896497 5:60705497-60705519 GGGGATCTCAGGGGCTGTAATGG - Intergenic
991003569 5:61806431-61806453 CAGGAGCTCAGAGGCACTGCTGG + Intergenic
993962148 5:94311961-94311983 CAGGAGCTCTGGAGCTCTGGTGG - Intronic
995120835 5:108533793-108533815 CATGTCCTCTGGGGCTCTGAGGG - Intergenic
999202494 5:149826267-149826289 CAGGGTCTGAGGGGCTGTAACGG + Intronic
1001011299 5:168101099-168101121 CAGGCTCTGAGGGTCACTGATGG + Intronic
1002841294 6:909567-909589 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841308 6:909645-909667 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841322 6:909723-909745 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841336 6:909801-909823 GATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841350 6:909879-909901 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841364 6:909957-909979 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841378 6:910035-910057 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841392 6:910113-910135 GATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841406 6:910191-910213 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841420 6:910269-910291 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841434 6:910347-910369 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841448 6:910425-910447 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841462 6:910503-910525 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841476 6:910581-910603 GATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841490 6:910659-910681 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1002841504 6:910737-910759 CATGATGTCAGGGGCTCTGAGGG - Intergenic
1003666301 6:8114896-8114918 CAGGACATCAGGGGCCATGATGG + Intergenic
1006263200 6:32894280-32894302 CAGCCTCTCTGGGGCACTGAGGG + Intergenic
1007451786 6:41945608-41945630 CAGCATCTCAATGGGTCTGAAGG - Intronic
1007723150 6:43897906-43897928 CTGGCTCCCAGGGGCTGTGATGG - Intergenic
1008245117 6:49161790-49161812 CAGGACCTCTGGGCCTGTGATGG + Intergenic
1009960536 6:70515582-70515604 CGGGTTGTCAGGGGCTCTGGGGG + Intronic
1013054952 6:106574502-106574524 CAGCATCCCAGGGGCTTTGGAGG - Intronic
1013551981 6:111216940-111216962 CACAATCTGAGGGCCTCTGAAGG - Intronic
1016385237 6:143524407-143524429 AAGGAGGTCAGGGGATCTGAGGG + Intergenic
1016918359 6:149265970-149265992 CAGGTCCTCAGGACCTCTGAGGG - Intronic
1017489485 6:154932332-154932354 CTTGATCCCAGAGGCTCTGATGG + Intronic
1018225068 6:161621066-161621088 CAGGCTGTCAGGGGCATTGATGG - Intronic
1018815307 6:167325842-167325864 CAGAAACTCAGGGGCTCTAGGGG + Intronic
1019171295 6:170134699-170134721 CAAGATGTCTGGGGCTTTGAGGG + Intergenic
1019207303 6:170373166-170373188 CAGGGTCCCAGGGCATCTGATGG - Intronic
1019613696 7:1949299-1949321 CAGGCTCTAAGGAGCTCTGCCGG + Intronic
1020148359 7:5662633-5662655 AAGGCTCTCAGCGGCACTGATGG - Intronic
1022878614 7:34563016-34563038 CAGGATGGCACGGCCTCTGAAGG - Intergenic
1022974409 7:35544305-35544327 CAGGAGCTCAGGGGATGTGGTGG - Intergenic
1023020796 7:36010309-36010331 CAGGCTCCCAGGGGCCCTGTTGG + Intergenic
1025212960 7:57031538-57031560 CAGGAGCTCAGGGTCTAGGAGGG - Intergenic
1025724626 7:64045540-64045562 CAGGATAACAGGGGCTATGGTGG - Intronic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1027696206 7:81413927-81413949 CTATATGTCAGGGGCTCTGAAGG + Intergenic
1027801418 7:82755897-82755919 CAGGATCTTATGCTCTCTGAAGG + Exonic
1028954898 7:96677610-96677632 TAGGATCAAAGGTGCTCTGATGG + Intronic
1032388592 7:131541149-131541171 CAGGAGCTAAGGCTCTCTGATGG + Intronic
1032428124 7:131838158-131838180 CAGGATCACAGGGGGTGAGACGG - Intergenic
1033843475 7:145403570-145403592 CTGGATCTCTGGGCCTGTGATGG - Intergenic
1034188471 7:149196384-149196406 CCAGAGCTCAGGGTCTCTGACGG + Intronic
1034232638 7:149543901-149543923 CAGTAACTCAGGAGCTCAGAAGG - Intergenic
1034274528 7:149818207-149818229 CAGTATCTGAGGGGTTTTGAGGG + Intergenic
1034991611 7:155551105-155551127 CAGGATATCAGGGCCCATGATGG + Intergenic
1035340613 7:158158407-158158429 CAGGACCTCAGGGTCACGGAAGG + Intronic
1035617578 8:1013491-1013513 CAGCATCACAGGGTCTCTGTGGG + Intergenic
1035924274 8:3710655-3710677 CATGGTTTCAGGGACTCTGAGGG - Intronic
1035945063 8:3953731-3953753 GAGCAGCTCAGGGGCTCTGTGGG - Intronic
1036446292 8:8824201-8824223 CACCTTCTCAGGGGCTCTGCGGG + Intronic
1036504996 8:9347225-9347247 CACGATCTCAGAGGCTCTGTGGG + Intergenic
1037361401 8:18078481-18078503 CAGTATTTCAGGGGCTCACATGG + Intronic
1038494209 8:27990189-27990211 CAGGAGCCCAGGGGATCTGCTGG + Intronic
1043162113 8:76858562-76858584 CAGGAACTCAGGCGCTCAGGTGG - Intronic
1043797254 8:84559721-84559743 CAGGATTTAAGGGGCTCAGGTGG + Intronic
1047675821 8:127200351-127200373 GGGAATCTCATGGGCTCTGAAGG + Intergenic
1048871636 8:138804022-138804044 CAGGAGCTGAGGGGCTGAGAGGG - Intronic
1049282708 8:141758633-141758655 CAGGAACCCAGGGGACCTGAAGG - Intergenic
1049438149 8:142597165-142597187 CAGGCCCTCAGGGGCTCTCTGGG - Intergenic
1049446359 8:142633302-142633324 CAGGAACCCATGGCCTCTGAGGG + Intergenic
1054313943 9:63561591-63561613 CTGGATCTCACGAGATCTGATGG + Intergenic
1054855322 9:69893115-69893137 CATGCCCTCAGGGGCTCTGGGGG + Intronic
1055960947 9:81819964-81819986 CAGGACTTCAGGACCTCTGAAGG + Intergenic
1056064947 9:82924282-82924304 CAGGTTCTCAGAGGCTCTCCCGG + Intergenic
1056068165 9:82958420-82958442 CAGCATCTCAGGGACTCTGCAGG + Intergenic
1058318496 9:103599428-103599450 CATGTCCTCTGGGGCTCTGAGGG + Intergenic
1059170009 9:112115988-112116010 CAAGAGCTCTGGGGCTTTGAAGG - Intronic
1059411509 9:114135209-114135231 CAGCGTCTGAGGGCCTCTGAGGG + Intergenic
1060403778 9:123362873-123362895 CAGGCACTGGGGGGCTCTGAAGG - Exonic
1060879637 9:127108994-127109016 GAGGGTCTCAGGGCATCTGAAGG + Intronic
1203436462 Un_GL000195v1:142479-142501 ATGGATCTCAGGGGCTCATAGGG + Intergenic
1185470498 X:378914-378936 CAGGAGCTCAGGGTTTCTGAAGG - Intronic
1185516318 X:701709-701731 CAGGATCACAGGGGCACTGAGGG - Intergenic
1186424928 X:9456438-9456460 CAGGCCCTCAGTGGCTCAGAGGG + Intergenic
1188540006 X:31239058-31239080 CAGTATATCAGGCACTCTGAGGG + Intronic
1190039561 X:47058853-47058875 CAGGTTCTCAGGCGGTCTGCAGG + Exonic
1190582546 X:51903041-51903063 CAGGATCTTATGGGCAGTGAAGG + Intergenic
1192281183 X:69687986-69688008 CAGGAGCTCTGGGGCTTGGATGG + Intronic
1194566840 X:95499537-95499559 CACCATCGCAGGGGCTGTGATGG - Intergenic
1196185420 X:112739969-112739991 CAGAATCCCAGGGCCTCTGATGG - Intergenic