ID: 1152177384

View in Genome Browser
Species Human (GRCh38)
Location 17:78796762-78796784
Sequence CCTCCCGGAGTCGTCGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152177384_1152177391 3 Left 1152177384 17:78796762-78796784 CCACCTGCGACGACTCCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1152177391 17:78796788-78796810 TGACGGGGACAGACCCGATGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1152177384_1152177392 7 Left 1152177384 17:78796762-78796784 CCACCTGCGACGACTCCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177384_1152177395 17 Left 1152177384 17:78796762-78796784 CCACCTGCGACGACTCCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1152177395 17:78796802-78796824 CCGATGAGGAAGGATGTTCACGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152177384 Original CRISPR CCTCCCGGAGTCGTCGCAGG TGG (reversed) Exonic