ID: 1152177384 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:78796762-78796784 |
Sequence | CCTCCCGGAGTCGTCGCAGG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 59 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 52} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152177384_1152177395 | 17 | Left | 1152177384 | 17:78796762-78796784 | CCACCTGCGACGACTCCGGGAGG | 0: 1 1: 0 2: 0 3: 6 4: 52 |
||
Right | 1152177395 | 17:78796802-78796824 | CCGATGAGGAAGGATGTTCACGG | 0: 1 1: 0 2: 1 3: 7 4: 116 |
||||
1152177384_1152177392 | 7 | Left | 1152177384 | 17:78796762-78796784 | CCACCTGCGACGACTCCGGGAGG | 0: 1 1: 0 2: 0 3: 6 4: 52 |
||
Right | 1152177392 | 17:78796792-78796814 | GGGGACAGACCCGATGAGGAAGG | 0: 1 1: 0 2: 0 3: 6 4: 137 |
||||
1152177384_1152177391 | 3 | Left | 1152177384 | 17:78796762-78796784 | CCACCTGCGACGACTCCGGGAGG | 0: 1 1: 0 2: 0 3: 6 4: 52 |
||
Right | 1152177391 | 17:78796788-78796810 | TGACGGGGACAGACCCGATGAGG | 0: 1 1: 0 2: 0 3: 4 4: 58 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152177384 | Original CRISPR | CCTCCCGGAGTCGTCGCAGG TGG (reversed) | Exonic | ||