ID: 1152177392

View in Genome Browser
Species Human (GRCh38)
Location 17:78796792-78796814
Sequence GGGGACAGACCCGATGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152177379_1152177392 28 Left 1152177379 17:78796741-78796763 CCAACACCACGTTGTCCATCTCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177380_1152177392 22 Left 1152177380 17:78796747-78796769 CCACGTTGTCCATCTCCACCTGC 0: 1
1: 1
2: 1
3: 28
4: 253
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177390_1152177392 -8 Left 1152177390 17:78796777-78796799 CCGGGAGGAAATGACGGGGACAG 0: 1
1: 0
2: 1
3: 27
4: 194
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177386_1152177392 4 Left 1152177386 17:78796765-78796787 CCTGCGACGACTCCGGGAGGAAA 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177381_1152177392 13 Left 1152177381 17:78796756-78796778 CCATCTCCACCTGCGACGACTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137
1152177384_1152177392 7 Left 1152177384 17:78796762-78796784 CCACCTGCGACGACTCCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1152177392 17:78796792-78796814 GGGGACAGACCCGATGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152177392 Original CRISPR GGGGACAGACCCGATGAGGA AGG Exonic