ID: 1152177395

View in Genome Browser
Species Human (GRCh38)
Location 17:78796802-78796824
Sequence CCGATGAGGAAGGATGTTCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152177386_1152177395 14 Left 1152177386 17:78796765-78796787 CCTGCGACGACTCCGGGAGGAAA 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1152177395 17:78796802-78796824 CCGATGAGGAAGGATGTTCACGG 0: 1
1: 0
2: 1
3: 7
4: 116
1152177390_1152177395 2 Left 1152177390 17:78796777-78796799 CCGGGAGGAAATGACGGGGACAG 0: 1
1: 0
2: 1
3: 27
4: 194
Right 1152177395 17:78796802-78796824 CCGATGAGGAAGGATGTTCACGG 0: 1
1: 0
2: 1
3: 7
4: 116
1152177384_1152177395 17 Left 1152177384 17:78796762-78796784 CCACCTGCGACGACTCCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1152177395 17:78796802-78796824 CCGATGAGGAAGGATGTTCACGG 0: 1
1: 0
2: 1
3: 7
4: 116
1152177381_1152177395 23 Left 1152177381 17:78796756-78796778 CCATCTCCACCTGCGACGACTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1152177395 17:78796802-78796824 CCGATGAGGAAGGATGTTCACGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152177395 Original CRISPR CCGATGAGGAAGGATGTTCA CGG Exonic