ID: 1152179169

View in Genome Browser
Species Human (GRCh38)
Location 17:78807146-78807168
Sequence GCCCCCCAGACCCCCAGGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152179169_1152179179 24 Left 1152179169 17:78807146-78807168 CCACTCCTGGGGGTCTGGGGGGC 0: 1
1: 0
2: 4
3: 37
4: 352
Right 1152179179 17:78807193-78807215 GTGCTCTGGGCTGGAGCTGCTGG 0: 1
1: 1
2: 7
3: 52
4: 533
1152179169_1152179176 11 Left 1152179169 17:78807146-78807168 CCACTCCTGGGGGTCTGGGGGGC 0: 1
1: 0
2: 4
3: 37
4: 352
Right 1152179176 17:78807180-78807202 CGCTGCTGGCCGAGTGCTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 111
1152179169_1152179173 -3 Left 1152179169 17:78807146-78807168 CCACTCCTGGGGGTCTGGGGGGC 0: 1
1: 0
2: 4
3: 37
4: 352
Right 1152179173 17:78807166-78807188 GGCCTTGGTGGAGTCGCTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 195
1152179169_1152179175 10 Left 1152179169 17:78807146-78807168 CCACTCCTGGGGGTCTGGGGGGC 0: 1
1: 0
2: 4
3: 37
4: 352
Right 1152179175 17:78807179-78807201 TCGCTGCTGGCCGAGTGCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 117
1152179169_1152179177 15 Left 1152179169 17:78807146-78807168 CCACTCCTGGGGGTCTGGGGGGC 0: 1
1: 0
2: 4
3: 37
4: 352
Right 1152179177 17:78807184-78807206 GCTGGCCGAGTGCTCTGGGCTGG 0: 1
1: 0
2: 0
3: 30
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152179169 Original CRISPR GCCCCCCAGACCCCCAGGAG TGG (reversed) Exonic
900308577 1:2022753-2022775 GCCCACGGGACCCCCAGGAGTGG - Intronic
900542227 1:3208872-3208894 CCCCCCCAGGTCCCCACGAGTGG + Intronic
900571063 1:3358470-3358492 GCGCCCCAGACTCCCAGCCGCGG + Intronic
900626221 1:3609912-3609934 GCTCCCCAGAGTCCCAGGGGTGG - Intronic
900650808 1:3729274-3729296 GTGCCCCAGACCCCCACGGGAGG - Intronic
901919461 1:12525938-12525960 GGCCTCCAGAGGCCCAGGAGAGG + Intergenic
902575494 1:17374717-17374739 GCCTCCAGGACCCTCAGGAGTGG + Intronic
902711723 1:18244482-18244504 GCAACCCAGTCACCCAGGAGTGG + Intronic
902918358 1:19652183-19652205 GCCCCCTAGACCCTTAGGAGAGG - Intronic
903265788 1:22157141-22157163 GCCCCCCAGACACCCTGGCTGGG - Intergenic
903577471 1:24347681-24347703 GCCCCTCAGGCCCCCTGGACAGG - Intronic
904160485 1:28518866-28518888 GTCCCCCAGCCCCGCAAGAGAGG - Intronic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
906152983 1:43598610-43598632 GCACCCCACTCCCCCAGGAAAGG - Intronic
906944863 1:50286996-50287018 GCTCCCAAGACCCCCCAGAGCGG - Intergenic
907319550 1:53594031-53594053 TCACCCCAGTGCCCCAGGAGAGG - Intronic
907341598 1:53739324-53739346 CCCGCCCAGACCCCCAGGGGGGG - Intergenic
908854179 1:68406040-68406062 CCCCCACAGACCTCCAGGATGGG - Intergenic
908932236 1:69331264-69331286 ACCCTCCAGAGCCACAGGAGTGG - Intergenic
910112845 1:83700914-83700936 GCCATCCAGACCCCCAGGTGGGG - Intergenic
910463292 1:87470671-87470693 GCCTGCCAGACCCCCAGCACAGG - Intergenic
912432329 1:109635213-109635235 CCCCTCCACTCCCCCAGGAGTGG - Intergenic
913109297 1:115642649-115642671 GCCCCCCAGGCCTCCAGGGCCGG - Intronic
914505809 1:148288095-148288117 GCCCCCGAGACACCCAGGCCCGG - Intergenic
915396730 1:155590687-155590709 GGCCCCGTGACCCCCCGGAGGGG + Intergenic
915556406 1:156663315-156663337 GGGCCCCAGAGCCCCAGGAAGGG - Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
916168849 1:161985750-161985772 GCCCCCCAGTTACCCAGCAGAGG - Intronic
919791940 1:201297347-201297369 GCCCCACAGACCTCAGGGAGAGG + Intronic
920201884 1:204264701-204264723 GCCCACCCAACCCCCAAGAGAGG + Intronic
920431375 1:205921298-205921320 GCTCCCAACACCCCCAGCAGTGG - Intronic
921077971 1:211715031-211715053 GCCTCCCAGACCTTCAGCAGGGG + Intergenic
922721919 1:227903783-227903805 GTCCCCCAGACCCCAGGGCGGGG - Intergenic
922822737 1:228495115-228495137 TCCCCCCAGGCCCCAAGGAAAGG - Exonic
923092556 1:230751220-230751242 GCTCCCCTGACCCCCAGGAGGGG + Intronic
1063944885 10:11166197-11166219 CCCCACCTGACCCCCAGGAATGG - Intronic
1064444134 10:15378754-15378776 GCACCCCAGGATCCCAGGAGAGG - Intergenic
1065189838 10:23199034-23199056 CCCCCCCAGAGTCCCAGGAGCGG - Intergenic
1069173403 10:65260858-65260880 CCCCATCATACCCCCAGGAGAGG - Intergenic
1069607763 10:69750410-69750432 GTCCCCCTGTCCCACAGGAGAGG - Intergenic
1069633357 10:69911032-69911054 GCCCCACTGGCCTCCAGGAGGGG - Intronic
1069849616 10:71396718-71396740 CCCGCCCGGACCCCCGGGAGCGG - Intergenic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070691920 10:78533354-78533376 ACCCTCCAGGCCCCGAGGAGAGG + Intergenic
1070964282 10:80520149-80520171 GCCACCCACTCCCCCAGGGGAGG - Exonic
1071083963 10:81846393-81846415 GGCCACCAGAGCCCAAGGAGTGG - Intergenic
1071603186 10:86968885-86968907 CCCGCCCAGGCCCTCAGGAGAGG + Intronic
1072964098 10:99956303-99956325 GCCCCCGAGAAGCCCAGGCGTGG - Exonic
1073146497 10:101285081-101285103 CCCTCCCAGACCCCCAGAATGGG + Intergenic
1076179502 10:128396192-128396214 GCCCCCCAGACCCACTGCACTGG + Intergenic
1076290276 10:129340556-129340578 CCCACCCCGACCCCCAGCAGTGG + Intergenic
1076512846 10:131024789-131024811 CCGGCCCAGGCCCCCAGGAGAGG - Intergenic
1076777122 10:132704121-132704143 GCCCCCCAGTCCCCCCAGACAGG + Intronic
1077167614 11:1150812-1150834 GCCACACTGACCCCCAGGAGTGG - Intergenic
1077184144 11:1228907-1228929 CCACCCCAGGACCCCAGGAGGGG + Intronic
1077371243 11:2182565-2182587 GCCCCACAGGTCCCCAGCAGCGG + Intergenic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1077461678 11:2713983-2714005 GCCCCCCACACACCCCTGAGTGG - Intronic
1077529010 11:3086505-3086527 GACCCCCAAGGCCCCAGGAGAGG - Intergenic
1077976282 11:7251925-7251947 CCTCCCCAGACACCGAGGAGAGG - Intronic
1078448683 11:11424312-11424334 GCCTCCCAGGCTTCCAGGAGTGG + Intronic
1079882547 11:25944797-25944819 GCCTCACACACCCCCAGGATAGG - Intergenic
1083259502 11:61515594-61515616 GCTCCCCGGAGCCCCAGGGGTGG - Intronic
1083800689 11:65044741-65044763 GCCTCCCAGAGCCCCAGGACTGG + Exonic
1084547584 11:69822170-69822192 GCCCCCCAGACCCCCACCCTGGG + Intergenic
1084805009 11:71572696-71572718 CATCCCCAGACCCACAGGAGAGG + Intergenic
1085041919 11:73331584-73331606 ACCCTCCAGGCCCCCAGGGGTGG - Intronic
1085644846 11:78216340-78216362 CCTCTCCAGGCCCCCAGGAGAGG + Exonic
1085848276 11:80090974-80090996 CCACCCCAGATCCCCAGGACAGG + Intergenic
1088598337 11:111455964-111455986 CACCCCCAGACACCCAGCAGGGG + Intronic
1089765236 11:120758215-120758237 GCCCCCCAGGTCCTCAGGATGGG - Intronic
1090142329 11:124277852-124277874 GCTCCCCAAAGGCCCAGGAGTGG + Intergenic
1090233707 11:125129785-125129807 GAACCCCAGAGGCCCAGGAGAGG + Intergenic
1090242615 11:125194588-125194610 GCTCACCAAAACCCCAGGAGAGG - Intronic
1091226421 11:133958937-133958959 GCCCTGCAGGCCCCTAGGAGAGG - Intergenic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1092230433 12:6772936-6772958 GACCTCCAGCCCCACAGGAGGGG + Intronic
1096468892 12:51864197-51864219 GCCTCCCAGACCCCCGGCACAGG + Intergenic
1097261060 12:57720545-57720567 GGCCCCCAGCCCTCCTGGAGTGG + Intronic
1099644463 12:85334434-85334456 GCCCCCCTCACCCCCAGCATAGG + Intergenic
1101923441 12:108951891-108951913 GCCACACAGATCCCCAGGAGGGG - Intronic
1101967878 12:109293326-109293348 GCCACCCAGACCCCAAGCACAGG + Intronic
1102993368 12:117330514-117330536 GGCCCCCAGGCCCCCAGGCCAGG - Exonic
1105016764 12:132790671-132790693 GCCCCTCAGATCTCCAGGGGCGG - Intronic
1105202843 13:18194566-18194588 CGCCCCCAGATCCCCGGGAGAGG + Intergenic
1105470042 13:20685240-20685262 GGCCCCCCCACCCCCGGGAGCGG - Intronic
1107110990 13:36698140-36698162 ACACCCCAGACCTTCAGGAGTGG + Intergenic
1107935269 13:45340991-45341013 GCACCCCAGACCCCCGTGTGCGG + Intronic
1111976095 13:94968278-94968300 GGACCCCACATCCCCAGGAGAGG - Intergenic
1112604180 13:100887937-100887959 GCCCTCCTGACCCCAAGGAAAGG - Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113935841 13:113995284-113995306 GCCCCAGAATCCCCCAGGAGAGG - Intronic
1118752479 14:68816895-68816917 GTCACCCAGACCCCCAAAAGGGG - Intergenic
1118776675 14:68978216-68978238 GCCCCTCCGACCCCCGGGAAAGG - Intronic
1120203062 14:81559536-81559558 GCCCCCCAGAAGCTGAGGAGAGG - Intergenic
1121091458 14:91185558-91185580 CCCACCCAGAGCACCAGGAGCGG - Intronic
1121631163 14:95422848-95422870 GTCCCCAAGACTCCCAGGAAGGG + Intronic
1121638168 14:95467680-95467702 GTCCCCCAGAATCCCAGGACTGG + Intronic
1122113289 14:99515892-99515914 GCCCCCCACCCCCCCGGGACTGG - Intronic
1122266687 14:100549965-100549987 GCCCCCCAGGCCCCCAGGCCTGG - Intronic
1122281645 14:100626532-100626554 GCCCTCCAGGCCCACTGGAGTGG + Intergenic
1122628003 14:103094096-103094118 GCCCGCCTGACCCCCTGGTGTGG + Intergenic
1122888178 14:104719796-104719818 GTCCCCCAGTCCCCCAGGCCAGG + Intronic
1122982302 14:105197192-105197214 GACCCCCAGACCCCAGGGCGGGG - Intergenic
1123987778 15:25660005-25660027 GAACCCCAGAACACCAGGAGAGG + Intergenic
1124124824 15:26929666-26929688 GCCCCCCAGAACCCCTGCTGGGG + Intronic
1124372499 15:29111599-29111621 GCCCTTCAGGCCCCCAGGTGCGG + Intronic
1124700143 15:31905447-31905469 TCCTTCCAGACCCCTAGGAGTGG + Intergenic
1125412004 15:39415770-39415792 GCCACCCCAACCCACAGGAGAGG + Intergenic
1125754392 15:42053067-42053089 GCCCCCCAGATGCCCCGGACAGG - Intergenic
1128087963 15:64898685-64898707 GCCCTCCAGATCCCCAGAAAAGG - Intronic
1129689720 15:77706294-77706316 GCCTGCCAGACCCCCTGGAGTGG + Intronic
1130335227 15:82952475-82952497 GCCCCGCAGTCCCTCCGGAGGGG + Intronic
1132478587 16:154406-154428 GCCTCCGGGACCCCCAGGACAGG + Exonic
1132480766 16:165162-165184 GCCTCCGGGACCCCCAGGACAGG + Intronic
1132546270 16:534797-534819 GCCCCCCACACCCCCAGCTCGGG + Intronic
1132613363 16:828621-828643 GGCCCCCAGACTCCCAGGTCAGG - Intergenic
1132671403 16:1103547-1103569 GCCCCTCAGGCCCCCAGGCTGGG + Intergenic
1132904625 16:2276216-2276238 GGCCCCCAGGCCGCCAGGAATGG - Exonic
1135729583 16:24883007-24883029 GCCCCCTAGACTTCCTGGAGAGG - Intronic
1136278146 16:29191662-29191684 GCCCAGGAGACCACCAGGAGCGG - Intergenic
1136579558 16:31143243-31143265 CCCCCCCACACCCCCTGGGGAGG + Intronic
1136774791 16:32866172-32866194 GCTTCCCAGGCCCCCAGGACAGG - Intergenic
1136895822 16:33995340-33995362 GCTTCCCAGGCCCCCAGGACAGG + Intergenic
1137017759 16:35393844-35393866 GCCCTCCAGGCCTCCAGGGGTGG + Intergenic
1137569060 16:49552859-49552881 GGCCCCCACCCCTCCAGGAGGGG + Intronic
1137582778 16:49644140-49644162 GGCCCACAGACTCACAGGAGTGG + Intronic
1137586430 16:49666709-49666731 GCTCACCAGACCCCCAGGGAGGG + Intronic
1137608964 16:49806217-49806239 GCACCCCAGCCCCCCAGGGAGGG + Intronic
1137698016 16:50475362-50475384 GACCCCCTCACCCCCAGGTGTGG + Intergenic
1138642552 16:58396974-58396996 GCGCCCCTCACCTCCAGGAGAGG + Intronic
1138680411 16:58679983-58680005 TCTGTCCAGACCCCCAGGAGAGG + Exonic
1139560376 16:67737968-67737990 AGCCCCCAGAAACCCAGGAGGGG + Intronic
1139953689 16:70683670-70683692 GCCTCCCAGAGGCCCAGGGGAGG + Intronic
1140477679 16:75247155-75247177 GCACCCCAGGCACCCAGGACAGG + Intronic
1140743537 16:77962216-77962238 CCCACCCACACCACCAGGAGGGG + Intronic
1141178751 16:81738273-81738295 GGTCCCCAGACCCCCGGGAGTGG - Intergenic
1141866257 16:86752043-86752065 GCTCCCCTGACCCCCAAAAGGGG - Intergenic
1142077620 16:88129306-88129328 GCCCGCCAGACCCCGCCGAGAGG - Intergenic
1203077215 16_KI270728v1_random:1128287-1128309 GCTTCCCAGGCCCCCAGGACAGG - Intergenic
1142719466 17:1766738-1766760 CCCCTCCAGGCCCCCAGAAGTGG - Intronic
1143411766 17:6713485-6713507 GTCCCACAGACCCCGAGGGGTGG - Exonic
1143626747 17:8114604-8114626 ACTCCCCCGACCCCCAGCAGTGG - Exonic
1143767075 17:9144900-9144922 GACCCCAGGACCCCCTGGAGAGG + Intronic
1144777366 17:17791587-17791609 GTGGCCCAGGCCCCCAGGAGGGG - Intronic
1145047972 17:19634052-19634074 GCCCACCAGATTCCCAGGAGAGG + Intergenic
1145304962 17:21668954-21668976 TCCCTGCAGACCCCCAGGACAGG - Intergenic
1147265367 17:39231396-39231418 GCACCCCAGGCCTCCTGGAGGGG + Intergenic
1147393071 17:40122082-40122104 GCCGCGGAGACCCCCGGGAGAGG + Intergenic
1147686428 17:42289058-42289080 GGCCCACAGGCCCCCTGGAGAGG - Intronic
1148111898 17:45149285-45149307 GCCCCCCAGGCGCGGAGGAGCGG + Exonic
1150790369 17:68197353-68197375 GCCCCCAAGGTCCCCAGCAGAGG + Intergenic
1151732195 17:75918091-75918113 GTCCCCGAGACCGTCAGGAGGGG - Intronic
1151936590 17:77265682-77265704 GCCCTCCGGACCTGCAGGAGGGG - Intergenic
1152093425 17:78259000-78259022 GCCACCCAGTCCCCCAGGCTGGG - Intergenic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1152229172 17:79106121-79106143 GTCCCCCGGGCCCCCAGGTGGGG - Intronic
1152306129 17:79521038-79521060 CCCTCCCAGACAGCCAGGAGTGG - Intergenic
1152640637 17:81447870-81447892 ACCCCCCAGAGTCCCAGCAGTGG + Intronic
1152760111 17:82103315-82103337 GCCCCCCAGGACCCCAGCAGGGG - Intronic
1154411595 18:14144882-14144904 GACGCCCATAGCCCCAGGAGGGG - Intergenic
1156144588 18:34159772-34159794 GCTCCCCAGACACCCGGGAAGGG - Intronic
1157516433 18:48314946-48314968 GCTGTGCAGACCCCCAGGAGGGG - Intronic
1157712324 18:49858516-49858538 GCCCCCCACCCCCCAGGGAGGGG + Intronic
1160118806 18:76108744-76108766 GCCCTCTAGACCCCCAGGGAAGG - Intergenic
1160504247 18:79418118-79418140 GCCCTGCAGACCCACAGGAAGGG - Intronic
1160540216 18:79617122-79617144 GGCCCCCGGATCCCCCGGAGAGG + Intergenic
1160540271 18:79617256-79617278 GCCCCCCAAGCTCCCTGGAGAGG + Intergenic
1160681205 19:412424-412446 GCCCTCCATCCCCCCAGGTGGGG + Intergenic
1160697307 19:491430-491452 GCCACCTAGACCCTCGGGAGAGG + Intronic
1160718823 19:588907-588929 GCCCACCAGACAGCCGGGAGGGG - Intergenic
1160747795 19:720041-720063 GCCCCCCGGACGCCCAGACGGGG + Intronic
1161072939 19:2271315-2271337 GCCGCCCGGACGCCCTGGAGGGG + Intronic
1161325580 19:3662122-3662144 GCCCCGGGGACCACCAGGAGGGG - Intronic
1161342848 19:3752464-3752486 GGCCCCCACACTCCCAGGAAGGG - Intronic
1161393244 19:4032073-4032095 CCCACCCAGACCCCCAGCCGGGG - Intronic
1161473449 19:4472589-4472611 GACCCCCAGACCCCCAGGGCGGG - Intronic
1161473557 19:4472886-4472908 GGCCCCCAGACCCCGGGGCGCGG - Intronic
1161995204 19:7707536-7707558 GCCCCCCAGAACTCCAGGAGGGG + Intergenic
1162016146 19:7847632-7847654 TCCTCTAAGACCCCCAGGAGGGG + Intronic
1162054884 19:8056510-8056532 GCCCCCTAGATGCCCAGCAGAGG - Intronic
1162067413 19:8134510-8134532 GCCTCCCACACCCCAGGGAGGGG - Intronic
1162324929 19:9993391-9993413 GCAACCCGGTCCCCCAGGAGAGG - Exonic
1162500513 19:11050836-11050858 GCCCCCCTGTCCCCAAGGAATGG - Intronic
1162679926 19:12333194-12333216 GCCCCCCATCTCCCCAGGATTGG - Intronic
1164717967 19:30407411-30407433 GCTCCCCACACACCCAGCAGTGG + Intronic
1165027391 19:32971794-32971816 GCCCCACAGAGCCCCACGCGCGG + Intronic
1166050363 19:40255550-40255572 GCCCCCCAACCCCCCAGGCTGGG - Intronic
1166307128 19:41941162-41941184 TCCCCGAACACCCCCAGGAGAGG + Intergenic
1166408998 19:42543770-42543792 GACACCGAGACTCCCAGGAGGGG - Intronic
1166704905 19:44903267-44903289 TCCCCCCCGACCCCCAAGGGGGG - Exonic
1166888245 19:45973929-45973951 GCCCCCCGGGCCCCCACTAGCGG - Intergenic
1167016125 19:46842272-46842294 GCCCTCCAGACCCCCAGGCTGGG + Intronic
1167119262 19:47507053-47507075 GCCACCCAGGCCCTCAGGAGAGG - Intronic
1167619872 19:50554883-50554905 GCCCCAAAGACCCCCAAGTGTGG + Intronic
1167792643 19:51690972-51690994 ACCTCCCAGACCCTCAGGCGGGG - Intergenic
925140352 2:1546022-1546044 ACCCAGCAGTCCCCCAGGAGCGG + Intergenic
925331611 2:3063021-3063043 GCCACACAGACCTCAAGGAGAGG + Intergenic
925385998 2:3461951-3461973 ACCGCCCAGACCGCCAGGTGGGG - Intronic
926132261 2:10311163-10311185 GCCCCCCAATCCCTCAGCAGTGG + Intronic
926207067 2:10841349-10841371 GAGCCCCAGACCTTCAGGAGGGG + Intergenic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
927697468 2:25247824-25247846 GCCCCCCAGATGCCCAGGGCTGG - Intronic
928313622 2:30230581-30230603 GCCCCCCAGAGCCACATGATGGG - Intergenic
932621020 2:73265063-73265085 GCCCCCCTGCCCCCCAGATGTGG + Intronic
932960690 2:76409192-76409214 ACCCCGCAGAGCCACAGGAGTGG + Intergenic
933248037 2:79997523-79997545 GCCCTCCAGTGCCCCAGCAGTGG + Intronic
933791737 2:85888787-85888809 GCCCCCGCGACGCCGAGGAGGGG + Intronic
936055083 2:109256526-109256548 GCCCCTCAAAGCTCCAGGAGTGG - Intronic
937046806 2:118856046-118856068 GCACCCCCCACCCCCCGGAGGGG - Intergenic
937882035 2:126875688-126875710 GAGCTCTAGACCCCCAGGAGTGG + Intergenic
938110338 2:128560063-128560085 GCCCACCAGACCTGCAGGAGTGG + Intergenic
945241619 2:207681684-207681706 GCCCCCCTGGGCCGCAGGAGAGG + Intergenic
946187084 2:217987275-217987297 GCCCCCCAGAGACCCAGGACAGG + Intronic
947069740 2:226274973-226274995 GCCCCCCCACCCGCCAGGAGAGG + Intergenic
947528582 2:230894346-230894368 GCACCCAAGACCCCAAGGAGCGG - Intergenic
947752893 2:232541945-232541967 GACCCAGAGACCCCCAGGGGTGG - Intronic
948430325 2:237914333-237914355 GGCCCCCGGGCCCCCAGGTGGGG + Intergenic
1169065781 20:2693427-2693449 CCCGCCCAGCGCCCCAGGAGGGG + Intronic
1169195068 20:3678452-3678474 GCCCTCCCCATCCCCAGGAGGGG - Intronic
1170706322 20:18747589-18747611 GCTGCCCTGAACCCCAGGAGTGG - Intronic
1171448400 20:25220387-25220409 GACCCCCAGAACCCCAGCAGGGG - Intronic
1172441841 20:34971536-34971558 GCTGCCCAGGGCCCCAGGAGGGG + Intergenic
1172852087 20:37973777-37973799 CCCCCTCAGAACCCCAAGAGAGG - Intergenic
1173680248 20:44874291-44874313 GCCCCCTAGCCCCCCAAGAACGG - Intergenic
1173898996 20:46573205-46573227 GCCACCCAGATCCCCATCAGTGG + Intronic
1174283731 20:49457519-49457541 GACCCCCAGACTCCCTGAAGTGG + Intronic
1174520822 20:51129240-51129262 GCCCTGCAGGCCCCAAGGAGAGG + Intergenic
1175943863 20:62549961-62549983 CCCACCCAGGCCACCAGGAGTGG - Intergenic
1176020344 20:62959434-62959456 GCCCCCCAGACCCCCAGAGTAGG - Intronic
1176026239 20:62986971-62986993 GGCCCACAGACACCCAGGAGGGG - Intergenic
1176128327 20:63485780-63485802 GCCCCACAGAGGCCCAGGATGGG + Intergenic
1176375832 21:6086530-6086552 GCCCCCAGGCCACCCAGGAGTGG + Intergenic
1176715113 21:10343439-10343461 CGCCCCCAGATCCCCGGGAGAGG - Intergenic
1176861459 21:14013543-14013565 GACGCCCATAGCCCCAGGAGTGG + Intergenic
1179435760 21:41361108-41361130 GCCCTCCAGACACCGGGGAGGGG - Intergenic
1179727444 21:43348343-43348365 ACCCCCAAGACCCCCAGGTGGGG - Intergenic
1179747642 21:43451714-43451736 GCCCCCAGGCCACCCAGGAGTGG - Intergenic
1180072612 21:45443881-45443903 GCCCTCCAGACTCCTAGGAAGGG + Intronic
1180603234 22:17036499-17036521 CGCCCCCAGATCCCCGGGAGAGG + Intergenic
1180835785 22:18928766-18928788 GCCCCACCCAACCCCAGGAGAGG - Intronic
1180844338 22:18973154-18973176 GTTCCACAGACCCCCAGGTGAGG - Intergenic
1181057133 22:20265557-20265579 GTTCCACAGACCCCCAGGTGAGG + Intronic
1181111912 22:20607315-20607337 GCCCCCCATGCCCCGGGGAGAGG + Intergenic
1181361100 22:22336745-22336767 GACCCCCAGCCCCCCCGGACAGG - Intergenic
1181431604 22:22884940-22884962 GCACCACAGACCCTCAGCAGGGG + Intronic
1181809030 22:25392334-25392356 GGACCCCAGTCCTCCAGGAGAGG + Intronic
1182240098 22:28909359-28909381 GCCCAACACGCCCCCAGGAGAGG - Intronic
1182341915 22:29629809-29629831 GCCCACCAGACCCCTATGAAAGG + Intronic
1182736031 22:32532781-32532803 GCCGCCCACACCCCGGGGAGGGG + Intronic
1183197563 22:36363872-36363894 GCTTCCCACACCCCCAGGAGGGG + Intronic
1183227939 22:36563256-36563278 GCCCCCCAGTCCCCTGGGAAGGG - Intergenic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
1184115550 22:42419777-42419799 GGCAGCCAGACACCCAGGAGTGG - Intronic
1184807610 22:46805619-46805641 GCTCCCCCTACCACCAGGAGTGG - Intronic
1185016489 22:48346217-48346239 GCCCCCCAGGCCCCCAAGGCAGG + Intergenic
1185179310 22:49350089-49350111 GCCCCTCAGATCCCCAGAAGAGG + Intergenic
1203285874 22_KI270734v1_random:154065-154087 GCCCCACCCAACCCCAGGAGAGG - Intergenic
950098396 3:10343261-10343283 CCCCTCCAGCCCCCGAGGAGGGG + Intronic
950264688 3:11564974-11564996 GCCGCAGAGACCCCCGGGAGCGG - Exonic
950319388 3:12036120-12036142 GCCCAGCAGACCCCTAAGAGGGG + Intronic
950431475 3:12953462-12953484 GTCACCCAGACCTCCAGAAGTGG + Intronic
950714505 3:14838120-14838142 GGCCCTCAGTCCCACAGGAGTGG - Intronic
953187836 3:40654846-40654868 ACCCCCCAAACCCCCTGGACAGG + Intergenic
954110077 3:48428944-48428966 AACCCCCAGACCCCGAGGCGAGG + Intronic
956280468 3:67550783-67550805 GCCGCTCAGACCCCTAGAAGGGG - Intronic
957374687 3:79340519-79340541 GTCTGCCAGACCCCCATGAGTGG + Intronic
957707142 3:83803726-83803748 TCCCCCAACACCCCCAGGATAGG + Intergenic
961863103 3:129933722-129933744 TCTGCCCTGACCCCCAGGAGTGG - Intergenic
962842913 3:139251909-139251931 GACCCTCAGAGCCCCAGAAGAGG - Intronic
964416771 3:156455959-156455981 GCCCCCCAGGCCCCCGCTAGAGG + Intronic
966762038 3:183427691-183427713 GGCCCCCCGACCCCCACCAGCGG + Intronic
966772595 3:183517414-183517436 GTCTCACAGTCCCCCAGGAGGGG + Intronic
967002369 3:185348599-185348621 GTCCCCTAGACCACGAGGAGTGG + Intronic
967087479 3:186108470-186108492 GCCCCCCAGAGCACCGGGAGGGG - Intronic
967559968 3:190906013-190906035 GCCCCACAAAGCCACAGGAGTGG + Intergenic
968282959 3:197490770-197490792 GCCCCACAGATTCCCAGAAGTGG + Intergenic
968285734 3:197507709-197507731 GACCCCCACAACCCCAGGGGAGG - Intergenic
968521458 4:1036429-1036451 GCCCTCCAGACCACCAGGCTGGG - Intergenic
968573187 4:1353201-1353223 GCACCCCTGACCCCCGGGACGGG + Exonic
968606975 4:1540191-1540213 GCCCCCCAGAGAGCCAGGTGGGG + Intergenic
968704672 4:2072353-2072375 ACCTCCCAGACCCCAAGCAGGGG + Intronic
968871614 4:3245517-3245539 GCACCCCACACCCCCAGGAACGG - Intronic
969584843 4:8085588-8085610 ACCCCCCAGACCCGCGTGAGTGG - Intronic
969584878 4:8085712-8085734 ACCCCCCAGACCCGCGTGAGTGG - Intronic
971343551 4:25792017-25792039 GCCCCCGAGTCCCCCTGGAAAGG - Intronic
973198704 4:47475889-47475911 GCTGCCCAGACCCCCACAAGAGG - Intergenic
973773274 4:54225533-54225555 GCCCCCCAAACCCAGAAGAGAGG + Intronic
975608833 4:76183714-76183736 ACCCCCCAACCTCCCAGGAGGGG - Intronic
977693811 4:99946341-99946363 GCCCCGCAGGCCTCCAGGAGGGG + Intronic
983455026 4:167952953-167952975 GGCCTCCAGGCCTCCAGGAGGGG - Intergenic
984571871 4:181404449-181404471 GCCCTGCAGAGCCACAGGAGTGG - Intergenic
985529408 5:424971-424993 GCCCCTCAGAGCCCCAGTGGTGG + Intronic
985530586 5:431608-431630 GCCCCCATGGCCCCCAGCAGCGG + Intronic
985626503 5:991673-991695 GCCACCCCCAACCCCAGGAGGGG + Intergenic
985640788 5:1062667-1062689 GCCCCCCAGCCCCCCAGCCCTGG - Intronic
986460033 5:7960592-7960614 GCCATCCAGAAGCCCAGGAGAGG - Intergenic
988264795 5:28934190-28934212 GCCCCCCCGCCCCGGAGGAGAGG + Intergenic
989180742 5:38574358-38574380 TCCTCCCAGACCCCCCGGACTGG + Intronic
989716416 5:44468400-44468422 GCCACCTGGGCCCCCAGGAGAGG + Intergenic
990567226 5:57041867-57041889 GCCACCCAGCCTCCAAGGAGGGG - Intergenic
997398354 5:133582280-133582302 GCACCCCAGACCCCCGGCACTGG + Intronic
998137439 5:139681566-139681588 GACCCCCAGGCCCCAAGGACTGG - Intronic
998375298 5:141686719-141686741 GCCTCCCAGACCCCCAGGCCAGG - Intergenic
999529277 5:152444425-152444447 GCCCCCCAGGACCCCTGCAGAGG - Intergenic
1001419111 5:171573644-171573666 ATACCCCAGACCCCCAGAAGAGG + Intergenic
1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG + Intronic
1002417969 5:179130603-179130625 GCTCCCCACAGCCCCAGAAGAGG + Intronic
1002903372 6:1428322-1428344 GAGCCCCAGTCACCCAGGAGAGG + Intergenic
1005009333 6:21321322-21321344 GCCTCCCAGACACCCAGAAGCGG - Intergenic
1006069376 6:31487050-31487072 GCCCCACAGGCACCCAGGATAGG - Intergenic
1006192682 6:32219418-32219440 ACACCCAAGACCCCTAGGAGAGG - Intronic
1006463575 6:34177777-34177799 GACCCCCCCACCGCCAGGAGAGG + Intergenic
1006838741 6:37014875-37014897 GCACCCCAACCCCCTAGGAGCGG + Exonic
1010221421 6:73451969-73451991 GCGCCCCGGACACCCAGGAGAGG - Exonic
1011434458 6:87322417-87322439 AGCCCGCAGACCCCAAGGAGGGG + Intronic
1013464037 6:110401044-110401066 GCACCCCGGAGCCCAAGGAGTGG + Intronic
1016224643 6:141720751-141720773 GCCCCCAAGTCCCACAGGAGTGG + Intergenic
1017352486 6:153458878-153458900 GCTCTCCCAACCCCCAGGAGTGG - Intergenic
1017756683 6:157535063-157535085 GCCTCCCAGACCACCCAGAGAGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019180489 6:170184539-170184561 GCCCGCCGGAGCCACAGGAGGGG + Intergenic
1019269497 7:139183-139205 GGCCCCAAGACCCAGAGGAGGGG + Intergenic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019531156 7:1504156-1504178 GCCTCCCAGCCGCCCGGGAGCGG + Intronic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1019739496 7:2665704-2665726 GCCCCACTGGCCCTCAGGAGAGG + Intergenic
1023343904 7:39251795-39251817 GCCCACCAGACCCCCAGCATGGG + Intronic
1023840936 7:44097114-44097136 GCCCTCCAGGCCCTCAGGGGTGG + Intergenic
1024373268 7:48610375-48610397 GCCCCACAGAACCACAGGGGCGG - Intronic
1025713596 7:63932520-63932542 GCCCTCCCTACGCCCAGGAGAGG + Intergenic
1026368890 7:69678224-69678246 GCCCCCAAGACCCACAGGCCTGG - Intronic
1026734908 7:72943219-72943241 ACCACCCAGACCGCCAGCAGCGG + Exonic
1026785241 7:73298134-73298156 ACCACCCAGACCGCCAGCAGCGG + Intergenic
1027108833 7:75421790-75421812 ACCACCCAGACCGCCAGCAGCGG - Exonic
1027174907 7:75897139-75897161 CCCCTCCACCCCCCCAGGAGAGG + Intergenic
1029403483 7:100359288-100359310 ACGCCCCACACCCCCAGAAGAGG + Intronic
1030225560 7:107146436-107146458 ACCCCACAGAGCACCAGGAGAGG - Exonic
1031513806 7:122678620-122678642 TCCACCCAGACCCACAGTAGTGG - Intronic
1031985723 7:128163573-128163595 GCCCCCCAGTCCCCAACCAGAGG - Intergenic
1032074997 7:128832003-128832025 GCACCCCACGGCCCCAGGAGGGG + Intronic
1033878238 7:145848846-145848868 GCACACCAGACCCCCAAGAGTGG - Intergenic
1034255736 7:149723816-149723838 GCATCCCAGTCCCTCAGGAGTGG + Exonic
1034967486 7:155400189-155400211 GCCCCTCAGTCACCCAGGTGAGG - Intergenic
1035595322 8:853293-853315 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035604390 8:920122-920144 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035888979 8:3324002-3324024 AACCCCCAGAGACCCAGGAGGGG + Intronic
1035889096 8:3324502-3324524 AACCCCCAGAGACCCAGGAGGGG + Intronic
1035909819 8:3554403-3554425 TCTCCCCAGACCCCCAGAGGGGG - Intronic
1037639881 8:20732817-20732839 CCCCCACAAACCCCCAGCAGAGG - Intergenic
1037764247 8:21762201-21762223 GGCCCCCTCACCACCAGGAGTGG + Intronic
1037892122 8:22628946-22628968 GCCCCCCAGCCTCCCCAGAGTGG - Intronic
1039883850 8:41644497-41644519 GACCCCCAGACCCCCAGGATGGG - Intergenic
1040107286 8:43548078-43548100 GCCCCCCAGGCACCCTGGGGTGG + Intergenic
1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG + Intergenic
1042704374 8:71650853-71650875 GCTCCCCAGCTCCCCAGCAGAGG - Intergenic
1045791386 8:105988369-105988391 GCCCTACAGAGCCACAGGAGTGG + Intergenic
1048847012 8:138611471-138611493 GCTCCAGAGCCCCCCAGGAGTGG - Intronic
1049758814 8:144322675-144322697 GTCCCCAAGACCCCCAGGCAGGG + Intronic
1049762189 8:144336642-144336664 GCCCCCCATGCCCCCGGGGGCGG + Intergenic
1049816835 8:144607565-144607587 CCCACCCCGCCCCCCAGGAGAGG + Intergenic
1049850074 8:144826322-144826344 GCCCTCCAGACCCCCAGGGCTGG - Intergenic
1052179327 9:25505280-25505302 GCCCCACAGAACCACAGGGGTGG - Intergenic
1053291629 9:36883159-36883181 GCCCCCCTGCCCCCTGGGAGTGG + Intronic
1057276480 9:93678381-93678403 GCCTCCCAGACCCCAAGATGTGG - Exonic
1058813291 9:108661532-108661554 GCCCACCCGGCCCCCAAGAGAGG + Intergenic
1059428381 9:114235519-114235541 CCCCCACAGACCCCCTGGCGAGG - Intronic
1059432427 9:114258275-114258297 ACTCCCCAGACTCCCAGGAAAGG + Intronic
1060492924 9:124098177-124098199 GCCAACCAGACCCCCAGGAGAGG + Intergenic
1060974124 9:127754847-127754869 GCAGCCCAGAGTCCCAGGAGTGG + Intronic
1061927139 9:133811458-133811480 GACCCCCAGGCTCCCAAGAGTGG - Intronic
1062276489 9:135733783-135733805 GCCCCCCATAGCACCAGGCGTGG + Intronic
1062391395 9:136335343-136335365 GACCCCAAGACCCCAAGGGGCGG - Intronic
1062442795 9:136578670-136578692 GCCCCACGGACCCCGGGGAGTGG - Intergenic
1062443701 9:136584573-136584595 GGGCCTCAGACCCCCAGCAGTGG - Intergenic
1062474456 9:136720327-136720349 GCCCCCCACACACCAAGGATGGG - Intronic
1062506996 9:136882620-136882642 GCCACCCAGGCCTCCAGCAGGGG - Intronic
1062611089 9:137373771-137373793 GCACCCCAGGCCCCCAGGGGCGG + Intronic
1186410475 X:9341600-9341622 GCCCCTCCAACCCCAAGGAGTGG - Intergenic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189353391 X:40293967-40293989 GCACCTCAGACTCCCAGGGGAGG + Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189484675 X:41421000-41421022 GCCCCCCTGCCCCCCACCAGTGG - Intergenic
1190541769 X:51484610-51484632 GCCCCGCAGCACCCCAAGAGAGG + Intergenic
1194254984 X:91624301-91624323 GCCACCTTGACCCCCAGCAGAGG - Intergenic
1196214631 X:113035941-113035963 CCTCCCCAGTCCCCCAGCAGTGG - Intergenic
1198586529 X:138128355-138128377 GCCCCCCCAAGGCCCAGGAGTGG - Intergenic
1200101021 X:153689074-153689096 GCCCCCCAGACTCCCGGGCTGGG + Intronic
1200105148 X:153707888-153707910 GCTTCCCAGGCCCCCAGGACAGG + Intronic
1200336043 X:155352574-155352596 GGTCCCCAGACCACCAGCAGTGG + Intergenic
1200350427 X:155488653-155488675 GGTCCCCAGACCACCAGCAGTGG - Intergenic
1200573769 Y:4863904-4863926 GCCACCTTGACCCCCAGCAGAGG - Intergenic