ID: 1152180528

View in Genome Browser
Species Human (GRCh38)
Location 17:78818178-78818200
Sequence CACCTGTTCTAGACATCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152180525_1152180528 10 Left 1152180525 17:78818145-78818167 CCATATTTCATAAAAAGCCAGAG 0: 1
1: 1
2: 0
3: 45
4: 457
Right 1152180528 17:78818178-78818200 CACCTGTTCTAGACATCAAAAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1152180527_1152180528 -7 Left 1152180527 17:78818162-78818184 CCAGAGCATGCAACGGCACCTGT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1152180528 17:78818178-78818200 CACCTGTTCTAGACATCAAAAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152180528 Original CRISPR CACCTGTTCTAGACATCAAA AGG Intronic
906884216 1:49627147-49627169 CAAATATTCTAGACATCAACAGG - Intronic
906913259 1:49979488-49979510 AACCTGTTATAGACATTACATGG + Intronic
907263466 1:53239132-53239154 CACCTATTCTAGAGATCAGTGGG - Intergenic
908690439 1:66773798-66773820 AACGTGTTTTAGAAATCAAAAGG - Intronic
909823406 1:80095123-80095145 AATCTGCTCTATACATCAAATGG - Intergenic
910922913 1:92368783-92368805 CACATATGCTACACATCAAAAGG - Intronic
911566566 1:99469170-99469192 CATATTTTTTAGACATCAAAGGG - Intergenic
915196606 1:154194375-154194397 CTTCTGTTCTGGACATCCAAGGG - Intronic
917735039 1:177912499-177912521 GACCAGTTCTAGACATTGAAAGG - Intergenic
920313445 1:205061758-205061780 CACCTGTGCCAGACAGCAGAGGG - Intronic
924026502 1:239838777-239838799 CTAATGTTCTACACATCAAAGGG - Intronic
1062806233 10:421853-421875 CTCCTGTTCCAGACAGAAAACGG + Intronic
1063843255 10:10095725-10095747 CACCTGTACTAGGCAACTAAAGG + Intergenic
1065337244 10:24665347-24665369 AACCTTTTCAAGACCTCAAATGG + Intronic
1066494104 10:35924937-35924959 GCACTTTTCTAGACATCAAAAGG + Intergenic
1068140013 10:52993927-52993949 AACCTTTTCTTGACATTAAAAGG + Intergenic
1076503837 10:130958551-130958573 CGACTGTGCTATACATCAAATGG - Intergenic
1080161651 11:29183874-29183896 CACATGTGCTAGACAGGAAAAGG - Intergenic
1082214770 11:49556062-49556084 CTCATGTTCTAGACTTCAAGGGG - Intergenic
1085792349 11:79506966-79506988 CTCCTGTTATAAACATCACAAGG + Intergenic
1086634818 11:89068401-89068423 CTCATGTTCTAGACTTCAAGGGG + Intergenic
1087258783 11:95986855-95986877 CACCTATTCTAAAGATCAAAAGG - Intronic
1088097819 11:106120264-106120286 CTCCTCTTTTACACATCAAAGGG - Intergenic
1094302957 12:28986431-28986453 CATCTTTTATAGACATCATATGG + Intergenic
1095227854 12:39698472-39698494 CATCTGTACTATAGATCAAATGG + Intronic
1097529876 12:60785460-60785482 CATCTCTTGTAGACATCATAGGG - Intergenic
1100697328 12:97109727-97109749 TACCTGTTTTAGACATCAAAGGG - Intergenic
1101741681 12:107504869-107504891 TCCCTGTTATAGAAATCAAAGGG - Intronic
1103196728 12:119050232-119050254 CACTTGTTCTAGGCATAACATGG + Intronic
1104186462 12:126436760-126436782 CAGCTACTCTAGAGATCAAAAGG + Intergenic
1106711428 13:32339023-32339045 CACCAGTTTTAGCCATCAATGGG + Exonic
1111548585 13:89778210-89778232 CACCTTTTTTATACATTAAAAGG + Intergenic
1117427991 14:55621067-55621089 CACCTGTCCTAGAGATCTGAGGG - Intronic
1117579562 14:57138519-57138541 CCCATGTTGTACACATCAAAGGG - Intergenic
1119343897 14:73905459-73905481 AACCTGTTCTAGGCACTAAATGG + Intronic
1125403479 15:39329005-39329027 AACCTGTTTTGGAAATCAAATGG - Intergenic
1126865928 15:52936777-52936799 CACCTGTTCTAGTCAATGAAAGG - Intergenic
1134851408 16:17481976-17481998 GACCTTTTCAAGACATCAAAAGG - Intergenic
1135945627 16:26862429-26862451 CACCTGTCCCAGGTATCAAATGG - Intergenic
1137518172 16:49168477-49168499 CACCTTTTCCAGAAATCACAGGG + Intergenic
1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG + Intergenic
1138809890 16:60137483-60137505 CATCTCTTGTAGACATCAGAAGG + Intergenic
1140227123 16:73087509-73087531 CACCAGTTTTAGATATCACAGGG + Intergenic
1141205234 16:81928296-81928318 AACCTGTTCTAGAATTCACAAGG + Intronic
1141608160 16:85167317-85167339 CACCTGCTCTAGAGAGGAAAGGG + Intergenic
1144602750 17:16632909-16632931 CATGTGTTCTGGAAATCAAAAGG - Intronic
1147015192 17:37486486-37486508 CACCTTATCTAGATATCATAAGG - Intergenic
1151872881 17:76848508-76848530 CCCAGGTTCCAGACATCAAAGGG + Intergenic
1152180528 17:78818178-78818200 CACCTGTTCTAGACATCAAAAGG + Intronic
1153503348 18:5770671-5770693 CAACTGATCTAGAACTCAAAGGG - Intergenic
1157200123 18:45652975-45652997 CACCTATTCCAGACATAACAGGG - Intronic
1158542095 18:58366365-58366387 AACCTGTTCTAGACTTGCAAGGG - Intronic
1164453571 19:28387393-28387415 CACTGGTTCAAGACATCCAAGGG + Intergenic
1164480549 19:28608084-28608106 TCCCAGTTCTAGACCTCAAACGG - Intergenic
1165471895 19:36008848-36008870 CACCTGAGCTGGGCATCAAATGG - Intergenic
1165509536 19:36257975-36257997 GACCTGTCCTCGACATCACAAGG - Intergenic
1165511064 19:36266937-36266959 GACCTGTCCTCGACATCACAAGG - Intergenic
1165631222 19:37304064-37304086 GACCTGTCCTCGACATCACAAGG + Intergenic
1166257764 19:41618676-41618698 CACCTTTTGTGGACATCAGATGG + Intronic
1166396185 19:42442970-42442992 CACCTGTTCTCGCCCTCAAATGG - Exonic
928451075 2:31379171-31379193 CACCAGGTCAAGACATCACAGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931957694 2:67446227-67446249 CACCAGTTCTAGACAATAAGAGG + Intergenic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
942277019 2:174330684-174330706 CACCAGTTGTTGAGATCAAATGG - Intergenic
942931978 2:181505083-181505105 CACCTAATCTACACATAAAAGGG - Intronic
943903179 2:193467438-193467460 CACTTTTTGTAGCCATCAAAGGG - Intergenic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1172184371 20:33022070-33022092 CATCTGCTCCAGATATCAAAGGG - Intronic
1176277164 20:64278987-64279009 CACCTTTCCTAGAGATTAAAGGG + Intronic
1176705728 21:10119195-10119217 GACCTGTCCTCGACATCACAAGG + Intergenic
1177091499 21:16774843-16774865 AACCTATTCTAGACATAACAAGG - Intergenic
1181809744 22:25396141-25396163 CCCCAGTTCAAGAGATCAAAGGG + Intronic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1183774666 22:39956104-39956126 CACATGGTGTAAACATCAAAAGG - Intronic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
952021209 3:29023300-29023322 CACTCGTTCTAGAAATCATATGG + Intergenic
952894323 3:38067167-38067189 CAACTGTTATGAACATCAAAGGG - Intronic
956830411 3:73041596-73041618 CACCATTTATAAACATCAAACGG - Intronic
957377368 3:79375841-79375863 AACCTGTTCTGGGCAACAAAAGG + Intronic
959309064 3:104708115-104708137 CACATTTTCTAGCCATCAACTGG - Intergenic
961815457 3:129547876-129547898 CACCTGTCCTGGACACCAACAGG - Intronic
962463835 3:135638895-135638917 CATCTCTTTTTGACATCAAAGGG - Intergenic
962473298 3:135732404-135732426 CACCTGTGCTAGACAAGAAATGG - Intergenic
962522219 3:136207997-136208019 CACCTGTTCTACATAGCATATGG + Intergenic
963073523 3:141325141-141325163 GACCTTTTCTAAATATCAAATGG - Intronic
964097835 3:152953740-152953762 CACCTGTTCTAGACAAAAGAAGG - Intergenic
964670441 3:159219518-159219540 CTCCTCTTCTGAACATCAAATGG - Intronic
966702234 3:182867361-182867383 TACCAATCCTAGACATCAAAAGG - Exonic
971432404 4:26581825-26581847 CACCTGCTCTAGGCAAGAAATGG - Intronic
979793994 4:124821402-124821424 CACTTCTTCTATATATCAAAAGG - Intergenic
980358952 4:131745270-131745292 GACCTGTCCTCCACATCAAAAGG - Intergenic
980377992 4:131975877-131975899 GACCTGTCCTCGACATCACAAGG + Intergenic
980378526 4:131978351-131978373 GACCTGTCCTTGACATCACAAGG + Intergenic
981328931 4:143485195-143485217 CAACTGTACTCCACATCAAATGG + Intergenic
981813185 4:148798802-148798824 CATCTGTTCTAGGCATCCCACGG - Intergenic
983229924 4:165119217-165119239 CAACCGTTCTAGGAATCAAAGGG + Intronic
986213090 5:5692354-5692376 CACCTGCCCCAGACTTCAAATGG - Intergenic
987263821 5:16230366-16230388 CACCATTTCTAGGCATCAAATGG + Intergenic
987785205 5:22490462-22490484 CTCCTGTTCTCGATATGAAATGG - Intronic
997632488 5:135379306-135379328 CACATGTTCTAGCCACTAAATGG + Intronic
997788400 5:136734722-136734744 CAGCTGTTCCAGACATAAAAAGG - Intergenic
999169163 5:149578759-149578781 TAAATGTTCTAGAAATCAAATGG + Intronic
999680498 5:154054950-154054972 CAACTGATCTAGACATCAAGAGG + Exonic
1015741754 6:136463016-136463038 CACCTATTCTAAATATCATAAGG + Intronic
1021009643 7:15445804-15445826 CACCTGTTCTTAAAATCTAAAGG + Intronic
1023499999 7:40838035-40838057 CACCTCTGCTAAACATCAACTGG + Intronic
1025482143 7:60994111-60994133 CACCTGTGCAGTACATCAAAAGG - Intergenic
1027346617 7:77266828-77266850 CACCTGCTCAAGACATTCAATGG + Intronic
1031702226 7:124941097-124941119 CATATCTTCTAGACATCAAGTGG - Intergenic
1037600941 8:20393189-20393211 GACCTGTTCTAGTCATATAAAGG + Intergenic
1039668200 8:39560733-39560755 TACCTTTTCTAGACCACAAAAGG - Intergenic
1052302597 9:26970981-26971003 CACAGGTGCTAGACATAAAATGG - Intronic
1053643012 9:40106312-40106334 GACCTGTCCTCGACATCACAAGG + Intergenic
1053763136 9:41359176-41359198 GACCTGTCCTTGACATCACAAGG - Intergenic
1054323862 9:63703539-63703561 GACCTGTCCTCGACATCACAAGG + Intergenic
1054541746 9:66270291-66270313 GACCTGTCCTCGACATCACAAGG - Intergenic
1055511889 9:77003255-77003277 CAACTGTTTTAGACACCATATGG + Intergenic
1202790762 9_KI270719v1_random:89284-89306 GACCTGTCCTCGACATCACAAGG + Intergenic
1187639105 X:21267624-21267646 CACCTGGTTTGGCCATCAAAGGG - Intergenic
1188808879 X:34626517-34626539 CACCATTTATATACATCAAAGGG + Intergenic
1189915142 X:45849520-45849542 CATCTTTTCTAGGCATCTAACGG + Intergenic