ID: 1152182073

View in Genome Browser
Species Human (GRCh38)
Location 17:78828707-78828729
Sequence CTTCAGTAACAGATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 262}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152182061_1152182073 26 Left 1152182061 17:78828658-78828680 CCTTCTACCAACTCCCCAGCACC 0: 1
1: 0
2: 4
3: 32
4: 423
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182069_1152182073 2 Left 1152182069 17:78828682-78828704 CCTACAGGGCGAGCACTTAGCAG 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182067_1152182073 11 Left 1152182067 17:78828673-78828695 CCAGCACCTCCTACAGGGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182068_1152182073 5 Left 1152182068 17:78828679-78828701 CCTCCTACAGGGCGAGCACTTAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182066_1152182073 12 Left 1152182066 17:78828672-78828694 CCCAGCACCTCCTACAGGGCGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182065_1152182073 13 Left 1152182065 17:78828671-78828693 CCCCAGCACCTCCTACAGGGCGA 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182062_1152182073 19 Left 1152182062 17:78828665-78828687 CCAACTCCCCAGCACCTCCTACA 0: 1
1: 0
2: 2
3: 64
4: 553
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262
1152182060_1152182073 27 Left 1152182060 17:78828657-78828679 CCCTTCTACCAACTCCCCAGCAC 0: 1
1: 0
2: 1
3: 16
4: 317
Right 1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152182073 Original CRISPR CTTCAGTAACAGATGGAGAA TGG Intronic
901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG + Intergenic
902326135 1:15702011-15702033 TATCAGTGACAGCTGGAGAAGGG - Intronic
905868583 1:41390279-41390301 CTCCAGTAACAAGTGCAGAATGG - Intergenic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
908531964 1:65042322-65042344 CTTCAGTATCTGAGGGAGATTGG - Intergenic
908733913 1:67256231-67256253 CTTCAGGAACAAAGGGAGTAGGG + Intronic
909860873 1:80604012-80604034 CTTGAGTTGAAGATGGAGAAAGG - Intergenic
910294817 1:85633806-85633828 TTTGAGTAAAAGAGGGAGAAGGG - Intergenic
910349757 1:86281804-86281826 CCTCAGTCTCAGAAGGAGAAAGG + Intergenic
910555353 1:88525898-88525920 CTTGAGTAAAAGATGGAGTCTGG - Intergenic
910840409 1:91555806-91555828 CTTCAGTGAGAGATGGGGAGTGG + Intergenic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
913015485 1:114729620-114729642 TTTTACTAACAGATGGAGACAGG - Intronic
915250479 1:154584779-154584801 CTCCAGTGACAGATGGATTAGGG - Exonic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
915853423 1:159352865-159352887 CTTCAGAAGCAGATGCAGATGGG + Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916423242 1:164656010-164656032 CTTCAATTGCAGGTGGAGAATGG + Intronic
918840859 1:189537428-189537450 CTACAGTAACCAATGGGGAAAGG - Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
922857772 1:228789882-228789904 CTTCAGCAACAGCTTGATAAAGG - Intergenic
924589008 1:245385772-245385794 CTTCTCCAACAGATGGAGACAGG + Intronic
1064437524 10:15324244-15324266 CTTTAGGAAAAGACGGAGAAAGG - Intronic
1064560103 10:16587523-16587545 CTTCAGTAACAAAACCAGAAAGG - Intergenic
1068559831 10:58501646-58501668 CTTAAGTAAAAGATGGAAAGAGG - Intergenic
1068600869 10:58955051-58955073 CACCAGTAACAAAGGGAGAAGGG + Intergenic
1070460041 10:76656850-76656872 CTACAGTAACAAAAGGAGCATGG + Intergenic
1070562989 10:77581818-77581840 CTTCAGTGACAGCCGGAGAGTGG - Intronic
1071291327 10:84191311-84191333 CCTCAGTACCAGATGGAGCCTGG + Intergenic
1073774139 10:106767265-106767287 CTTCAGTGACAGCTGGGGAATGG - Intronic
1074074758 10:110112804-110112826 ATTCAAGAACAGATGAAGAAAGG + Exonic
1075287255 10:121197745-121197767 CTTCAGTAACAGCTGGATTGGGG - Intergenic
1076446148 10:130515703-130515725 CTTCAGTGCCAGTTAGAGAAGGG + Intergenic
1078601873 11:12739745-12739767 AATCAGTAACAGAGGGAGAGAGG - Intronic
1080473875 11:32571913-32571935 CTTCAGAAAGAGATGGGGAGAGG + Intergenic
1080794943 11:35554481-35554503 CTTTAGTAACAGATAGACTAGGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084719074 11:70892583-70892605 CTTCAGCATCAGATGGACATGGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086319210 11:85627860-85627882 CTTCTGTAAGACATGGAGACTGG + Intronic
1086412269 11:86554526-86554548 CTTCAGTAACTATTGTAGAAAGG - Intronic
1087926179 11:103921165-103921187 CTTCACTTAAAGGTGGAGAAAGG + Intronic
1088704686 11:112451373-112451395 TTTCAGTGGCAGATGGAAAAGGG - Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089840819 11:121415968-121415990 CTTCAGTTCCAGCTGGAAAAGGG + Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1091238331 11:134036474-134036496 CTTGAGTACCAGCTGTAGAAGGG + Intergenic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1092966202 12:13645864-13645886 TTTAAGTAACAGAAAGAGAAGGG + Intronic
1093213670 12:16337425-16337447 CTTCAGGAGCAGTTGGGGAAAGG - Intergenic
1093458494 12:19387182-19387204 CTTAAGTAGCAGATGCTGAAGGG + Intergenic
1094082795 12:26555876-26555898 TTTCATTAACATAGGGAGAAAGG - Intronic
1094152001 12:27295008-27295030 TTTCAGGATCAGATGCAGAAAGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095271244 12:40221905-40221927 CTTCAGAAATTGATAGAGAAAGG + Intronic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1095539991 12:43298207-43298229 CTTCTGTACCAGATGGTAAATGG - Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1099330982 12:81286694-81286716 CTTAAGTAACAAATGGAAATGGG + Intronic
1100027360 12:90146932-90146954 CTACTGTAACAAAGGGAGAAGGG - Intergenic
1100607279 12:96162111-96162133 CATAAGCACCAGATGGAGAAGGG - Intergenic
1101021187 12:100555924-100555946 ATTCTGTAACAGCTGGATAAAGG + Intronic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1103097818 12:118146152-118146174 CTGCAGTGAAAGATGGGGAAGGG - Intergenic
1103249098 12:119484789-119484811 TTTCAGTTACTGATGGAAAATGG - Intronic
1103617939 12:122166876-122166898 TTTCAGTGACAGAAGGAGAAAGG + Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1107737879 13:43417181-43417203 CCTCAGCAACAGAGGGAGACGGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112759531 13:102678250-102678272 TTTCAGTAAAAGATGCACAATGG - Exonic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1120108499 14:80524361-80524383 CTTCTGAAACTGATGGAGTAAGG + Intronic
1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG + Intergenic
1125095252 15:35842940-35842962 ACTCAGTGAAAGATGGAGAAGGG - Intergenic
1125463534 15:39928644-39928666 CTTTAGTAAAAGATGGAATATGG + Intergenic
1125670844 15:41471592-41471614 CTTCAGTATAAAAGGGAGAAGGG + Intronic
1125977768 15:43970750-43970772 CTTCAGAAATAGATGGGGTATGG - Intronic
1126342370 15:47655128-47655150 CTTCAGTAAGAGATCAAGAAAGG - Intronic
1129567452 15:76637972-76637994 ACTCAGTAACAGATGGGCAAAGG - Intronic
1130543329 15:84837806-84837828 CTACAGTGAGAGATGGAAAAAGG - Intronic
1130685764 15:86035961-86035983 CTTCAGGAAAAAAGGGAGAAGGG + Intergenic
1130817471 15:87453098-87453120 CTTCAGATACAGATAGATAATGG + Intergenic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1138213192 16:55180273-55180295 CTTCAGGAACTGATGGGGAAGGG + Intergenic
1139367603 16:66443140-66443162 CTTCAGCAAAGGATGGATAATGG - Intronic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1147504849 17:41005817-41005839 CATCACTAACAGGTGAAGAAAGG - Intergenic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149295322 17:55256860-55256882 ATGCATTAACAGATGGGGAATGG + Intergenic
1150934307 17:69618523-69618545 CTTCAGTACCAGAAGCTGAAAGG - Intergenic
1151374624 17:73678269-73678291 CCTCAGTATCAGAGGAAGAAGGG + Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152335147 17:79696517-79696539 CTTCTGTATCAGAGGGAGATAGG - Intergenic
1153183855 18:2465798-2465820 TTTCAGTCAGAGATGGAGAAGGG - Intergenic
1155770924 18:29697119-29697141 TTATAGTAACAGATGGTGAAAGG - Intergenic
1159206178 18:65255817-65255839 CTTCAAGAACAGATAGAGAAAGG - Intergenic
1159286996 18:66366722-66366744 CTTTATTAACAGAGTGAGAATGG + Intergenic
1159843099 18:73423938-73423960 CTTCAGTAGCAAACAGAGAATGG + Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163779798 19:19240208-19240230 CCTCTGTAAGAGCTGGAGAAGGG - Intronic
1165761816 19:38326059-38326081 CTTCACTGACAGATGGAGTGCGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
925120247 2:1412644-1412666 CATCAGTCACATTTGGAGAAGGG + Intronic
926054226 2:9764849-9764871 CTTCAGGAACAAATGAAGCAGGG - Intergenic
928129924 2:28642013-28642035 CTCCAGGAACAGATGGCAAAAGG - Intronic
928267017 2:29820873-29820895 AGTCAGGAACAGAAGGAGAAGGG - Intronic
928923143 2:36547370-36547392 CTTCATTAACCAATGGATAATGG - Intronic
931804205 2:65788782-65788804 CCTGAGTAACAGATGGAGGCAGG - Intergenic
933784865 2:85830514-85830536 CATCGGCAAAAGATGGAGAAGGG + Intergenic
934539260 2:95160458-95160480 ATTCAGGGGCAGATGGAGAAAGG - Intronic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938419275 2:131131111-131131133 CTTGTGTAACAATTGGAGAATGG + Intronic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
939529857 2:143344799-143344821 CTTCAGTAAAAAGAGGAGAAAGG + Intronic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
942693982 2:178617884-178617906 CATCAGTAACAGTTGCAGACAGG + Exonic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946210332 2:218142765-218142787 CTTCAGTAAGAGTTGAATAAAGG + Intergenic
946665473 2:222045265-222045287 TTTCAGAGACTGATGGAGAATGG + Intergenic
1168798289 20:626883-626905 ATTAAGTAACAGAGGGAGACGGG - Intergenic
1170503993 20:17005019-17005041 TTTAAATAGCAGATGGAGAAAGG - Intergenic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1170761307 20:19253770-19253792 CTTCTGGAGGAGATGGAGAAAGG + Intronic
1172400183 20:34643966-34643988 CTTTACTAACAGATAAAGAAGGG - Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1173824243 20:46037166-46037188 GTTCAGTGACAGAGGCAGAAGGG - Intronic
1177285430 21:19042460-19042482 TTTCAGTAGCAGATGGGGAGAGG - Intergenic
1178058176 21:28822682-28822704 CTTCAGTAATAACTGGGGAAAGG - Intergenic
1178471858 21:32900859-32900881 CCGCATTAACAGATGGGGAATGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1183622191 22:38981070-38981092 CGTCAGAAAGAGATGGACAAAGG - Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
953533432 3:43758476-43758498 CTTCAGTAGCAGCTGTGGAAGGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
959510803 3:107209483-107209505 CTTTTGTAACAGATGAAGAAAGG - Intergenic
960467332 3:118013526-118013548 GTGCACTAACAGAAGGAGAAGGG + Intergenic
960965841 3:123104228-123104250 CTTCAGTTTCAGTTGGAGAGAGG + Intronic
962044211 3:131738507-131738529 TTTAAGCAACAGATGGGGAAGGG + Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
968303031 3:197630567-197630589 ATACCGTAAGAGATGGAGAAAGG - Intergenic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
971607621 4:28678641-28678663 CCTCAGTAAGAGATAGGGAATGG - Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
972763214 4:42127548-42127570 CTTGAGAAACAAATGGAGACAGG + Intronic
976075470 4:81294013-81294035 AATCAGTAGCAGTTGGAGAAGGG + Intergenic
976358979 4:84155237-84155259 CCTCAGAAAGAGATGCAGAAAGG - Intergenic
976541943 4:86287993-86288015 ATTGAGTAACATATGGAAAATGG + Intronic
976633955 4:87268658-87268680 CTTCAGATTCAGATTGAGAAGGG + Intergenic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
978045084 4:104115476-104115498 CTTTATTAGCAGATTGAGAATGG - Intergenic
979926780 4:126577449-126577471 ATTCAGGAAGAGGTGGAGAAGGG - Intergenic
980912997 4:139010350-139010372 CTTTGGTAACTGATGGATAATGG - Intergenic
981033209 4:140146292-140146314 CTTCTGTCCCAAATGGAGAAAGG + Intronic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
983091619 4:163510183-163510205 CTTCATAAAAAGTTGGAGAATGG - Intronic
986008721 5:3692319-3692341 CTCCAGTAACAAATAGAGGAAGG + Intergenic
986274781 5:6264078-6264100 CTTTATTAACAGAGTGAGAATGG + Intergenic
986293984 5:6422384-6422406 CGTGAGTAACTGATGGAAAATGG - Intergenic
987251443 5:16105281-16105303 CCTCAGTAAGGAATGGAGAAAGG + Intronic
987298154 5:16572702-16572724 CTCCAATAGCCGATGGAGAATGG + Intronic
989005289 5:36804105-36804127 TTTTAATAAAAGATGGAGAAGGG + Intergenic
990601353 5:57361610-57361632 CTTCGCTTTCAGATGGAGAAAGG + Intergenic
991218622 5:64185855-64185877 CATAAGTAACAGATGAACAAAGG + Intronic
992344963 5:75867288-75867310 CTTCAGTAGCAGATGCAACAGGG + Intergenic
993658978 5:90606913-90606935 CTCCAGTAACATCTTGAGAAAGG + Intronic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996116599 5:119627036-119627058 CTTCAGGGGCAGATGTAGAATGG + Intronic
996136216 5:119845724-119845746 CTTCAGTATATGGTGGAGAAGGG - Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
997507568 5:134430177-134430199 CCTAAGGGACAGATGGAGAAAGG + Intergenic
999174494 5:149622229-149622251 CTTCACTAACAGAGGGAGACTGG - Intronic
999290025 5:150418459-150418481 GTTCAATAACAGCTGGAAAAAGG + Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1001787831 5:174428674-174428696 CTTCAGTAATAGATGGATTTGGG + Intergenic
1002587248 5:180256974-180256996 CTTCAGGAACAGAAATAGAATGG + Intronic
1003004690 6:2369880-2369902 CTTCAGTTAAGGATGTAGAAGGG + Intergenic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003937554 6:10991133-10991155 CTTCAGGAAACCATGGAGAAAGG + Intronic
1005649504 6:27873648-27873670 CTTCAGGAAAAAATGGAAAAGGG + Intergenic
1006429653 6:33988023-33988045 CTTCGGGATCAGCTGGAGAACGG + Intergenic
1007071057 6:39038450-39038472 CTTCATGAACAGATGTGGAAGGG - Intergenic
1008229426 6:48966146-48966168 TTTACGTAACAGGTGGAGAAGGG + Intergenic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1009055406 6:58328755-58328777 CTTCATTATCACAGGGAGAATGG - Intergenic
1009235759 6:61121827-61121849 CTTCATTATCACAGGGAGAATGG + Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012834842 6:104252043-104252065 CTACTGTAACAGAGGGAGCAAGG + Intergenic
1013343680 6:109239071-109239093 ATTCAGTAGCAACTGGAGAAAGG - Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013806498 6:114001947-114001969 CTTCAGTAGGGAATGGAGAAGGG - Intronic
1014471753 6:121823821-121823843 CTTAAGTAACACAAGTAGAAAGG + Intergenic
1016901503 6:149107603-149107625 CTTCAGTGACAGAAGTAAAATGG + Intergenic
1018664306 6:166120530-166120552 CTTCAGTAACTCATTGAGACAGG - Intergenic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023651811 7:42378273-42378295 CTCCAGTGTCAGTTGGAGAAAGG + Intergenic
1024924832 7:54601577-54601599 CTTCTGGAACAGATGTAGTACGG - Intergenic
1026813792 7:73492863-73492885 CTTCATTAAAAAAAGGAGAAAGG - Exonic
1028875065 7:95812686-95812708 CCTAAGTGACAGATAGAGAAAGG - Intronic
1030114303 7:106051428-106051450 CACCAGTAAAAGATGAAGAAGGG - Intergenic
1030125844 7:106151829-106151851 CTCCAGTAACAGAAGGAGGGAGG + Intergenic
1031983626 7:128147949-128147971 ATTCTGTAGCCGATGGAGAATGG + Intergenic
1033092074 7:138394819-138394841 GTTCAGTAACAGGAAGAGAATGG + Intergenic
1033514629 7:142093851-142093873 CTTCAGTTACAGGAGGTGAAGGG + Intronic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034442653 7:151094457-151094479 CTTACGTATCAGATGAAGAAGGG - Intronic
1034942556 7:155240383-155240405 CTCCTGTAAAAGATGAAGAATGG + Intergenic
1035615347 8:995986-996008 CTTCAGAACCACATGGAAAAGGG - Intergenic
1036644495 8:10603172-10603194 ATTGAGTGAGAGATGGAGAAAGG + Intergenic
1037424035 8:18735111-18735133 ATTCAGTAAGAGTTTGAGAAGGG + Intronic
1037424129 8:18736531-18736553 ATTCAGTAAGAGTTTGAGAAGGG + Intronic
1038124116 8:24652176-24652198 CTTCAGTACCAGAAGGGGTATGG - Intergenic
1038497579 8:28014770-28014792 TTCCACTGACAGATGGAGAAGGG + Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1042258986 8:66837467-66837489 CTTTTGTGACAGATGTAGAAAGG - Intronic
1042417084 8:68533088-68533110 CTTCTGTTACAGATGGGGTAGGG - Exonic
1042549370 8:69980679-69980701 TGCCAGTAAAAGATGGAGAAGGG + Intergenic
1045231551 8:100311046-100311068 GTTAAGTAACAGATGGCAAATGG - Intronic
1046319865 8:112558396-112558418 TATCAGTAATAGATTGAGAATGG - Intronic
1046459650 8:114517392-114517414 CTTCTGTAGAAGATGCAGAAAGG + Intergenic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047242038 8:123099534-123099556 TTTAAGTAACATTTGGAGAATGG - Intronic
1047623034 8:126627732-126627754 CCTGAGGAACATATGGAGAAAGG - Intergenic
1048564765 8:135584013-135584035 CTTTGGTAGCAGATGGAAAAGGG - Intronic
1050324124 9:4483792-4483814 TGTCAGTAACAGGAGGAGAAAGG - Intergenic
1050469062 9:5965968-5965990 ATTCAGTAACTGATGAAAAAAGG + Intronic
1050752035 9:8950378-8950400 ATTTAGGAACATATGGAGAAGGG + Intronic
1051032607 9:12700246-12700268 CTCCAGTAAAAGATGACGAATGG - Intronic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052636161 9:31107414-31107436 ATTTAGTGACACATGGAGAATGG - Intergenic
1053589939 9:39502345-39502367 CCTCATTAAAAAATGGAGAAAGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054576361 9:66862946-66862968 CCTCATTAAAAAATGGAGAAAGG - Intronic
1055273940 9:74593042-74593064 TTTCAGTAATGGATGGACAAAGG - Intronic
1057058686 9:91983798-91983820 CATCAGAAACAGATGCAGACAGG + Intergenic
1060898102 9:127232260-127232282 CTTCAGTAGCTGAAGGAGAAGGG - Intronic
1062194905 9:135267570-135267592 CTTCAGTTACAGATGGACTTTGG + Intergenic
1185872669 X:3677022-3677044 CTTCATTAACAGCATGAGAATGG + Intronic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1188279195 X:28242361-28242383 GTTCAGAGACAGATGTAGAAGGG - Intergenic
1188706888 X:33345375-33345397 CATCAGTAACAGCAAGAGAATGG - Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1189838467 X:45044400-45044422 TTTCAGTAACAGAATGAAAAGGG - Intronic
1189918563 X:45881168-45881190 CTTCAGTAACATTTGGCAAACGG - Intergenic
1191017103 X:55820457-55820479 CCTCATTAACAAATGGACAAAGG - Intergenic
1192135659 X:68597226-68597248 GTTCACCAACAGATGAAGAAAGG + Intergenic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1194284080 X:91988296-91988318 CTTCAGTATGAGGAGGAGAAGGG - Intronic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1198963874 X:142207833-142207855 CTGCTGTAACACCTGGAGAAAGG - Intergenic
1199912963 X:152307751-152307773 CCTGAGTAACTCATGGAGAAGGG + Intronic