ID: 1152182204

View in Genome Browser
Species Human (GRCh38)
Location 17:78829822-78829844
Sequence TGCTTAAACCCGGCAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156002
Summary {0: 2, 1: 214, 2: 6945, 3: 41384, 4: 107457}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152182204_1152182210 8 Left 1152182204 17:78829822-78829844 CCTCCGCCTGCCGGGTTTAAGCA 0: 2
1: 214
2: 6945
3: 41384
4: 107457
Right 1152182210 17:78829853-78829875 GCCTCAGCCTCCCAAGTGGCTGG 0: 1328
1: 85085
2: 197090
3: 302866
4: 346625
1152182204_1152182214 17 Left 1152182204 17:78829822-78829844 CCTCCGCCTGCCGGGTTTAAGCA 0: 2
1: 214
2: 6945
3: 41384
4: 107457
Right 1152182214 17:78829862-78829884 TCCCAAGTGGCTGGGACTACAGG 0: 649
1: 44367
2: 158188
3: 234932
4: 538437
1152182204_1152182208 4 Left 1152182204 17:78829822-78829844 CCTCCGCCTGCCGGGTTTAAGCA 0: 2
1: 214
2: 6945
3: 41384
4: 107457
Right 1152182208 17:78829849-78829871 TCCTGCCTCAGCCTCCCAAGTGG 0: 1238
1: 2966
2: 4676
3: 5001
4: 5368
1152182204_1152182212 9 Left 1152182204 17:78829822-78829844 CCTCCGCCTGCCGGGTTTAAGCA 0: 2
1: 214
2: 6945
3: 41384
4: 107457
Right 1152182212 17:78829854-78829876 CCTCAGCCTCCCAAGTGGCTGGG 0: 1640
1: 97193
2: 210925
3: 350149
4: 382985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152182204 Original CRISPR TGCTTAAACCCGGCAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr