ID: 1152185526

View in Genome Browser
Species Human (GRCh38)
Location 17:78854322-78854344
Sequence GCTTCAGGAAACCACACTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152185522_1152185526 -10 Left 1152185522 17:78854309-78854331 CCCCATATCACTGGCTTCAGGAA 0: 1
1: 1
2: 0
3: 20
4: 235
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210
1152185521_1152185526 -9 Left 1152185521 17:78854308-78854330 CCCCCATATCACTGGCTTCAGGA 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210
1152185515_1152185526 26 Left 1152185515 17:78854273-78854295 CCTTATCATTACCGAGAAAGTTC 0: 1
1: 0
2: 1
3: 1
4: 76
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210
1152185517_1152185526 1 Left 1152185517 17:78854298-78854320 CCTATCCTAACCCCCATATCACT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210
1152185519_1152185526 -4 Left 1152185519 17:78854303-78854325 CCTAACCCCCATATCACTGGCTT 0: 1
1: 0
2: 1
3: 12
4: 205
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210
1152185516_1152185526 15 Left 1152185516 17:78854284-78854306 CCGAGAAAGTTCTTCCTATCCTA 0: 1
1: 0
2: 0
3: 20
4: 214
Right 1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152185526 Original CRISPR GCTTCAGGAAACCACACTGA GGG Exonic
900692608 1:3990103-3990125 GCCTCAGGAAACTACAGTCATGG - Intergenic
900723194 1:4193884-4193906 GCCTCAGGAAACTACAATCATGG - Intergenic
901242373 1:7703164-7703186 GCGTCAGGAAAAGCCACTGAGGG + Intronic
902076343 1:13789930-13789952 GCTTCAGGCAGCCTCAGTGAAGG + Intronic
902188561 1:14743931-14743953 GCTTCAGGAAACCTCATTCTTGG - Intronic
902582906 1:17420104-17420126 ACTTCAGGGAACCGCACTTAGGG + Intronic
905544550 1:38787235-38787257 TCTTGTGGAAACCACAGTGAAGG - Intergenic
907299658 1:53478647-53478669 CCCTCAGGAAACCACGGTGATGG - Intergenic
909224859 1:73006244-73006266 GCTTGAGGAACCCACAAAGAAGG - Intergenic
909325292 1:74343739-74343761 GCTCTAGAAAAGCACACTGAAGG + Intronic
910649216 1:89546746-89546768 GCTTCAGAAAGCTACACTGAGGG - Intronic
910707908 1:90149210-90149232 GTTTTGGGAAACCAAACTGATGG + Intergenic
911252517 1:95593520-95593542 GCTTCAAGAAAAAATACTGAAGG + Intergenic
914913771 1:151805850-151805872 TCTTCAGGAACCCCCACTGTAGG - Exonic
916077274 1:161209125-161209147 GCTTCAGGCAGCCAGACTGTGGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917084019 1:171287235-171287257 GCTTCAGGTACTCTCACTGATGG - Intergenic
917526570 1:175793415-175793437 TCTTCAGGAAAGCACTCAGATGG + Intergenic
920125244 1:203689132-203689154 TCCACAGGAAACCACACAGAAGG - Intronic
920649908 1:207829442-207829464 GGTTTAGGAAAATACACTGAGGG + Intergenic
920841955 1:209562513-209562535 GCTTCAGGAAACCAAACAATGGG + Intergenic
921339733 1:214122677-214122699 TCTTCAGGAAGCCAAACTCAGGG - Intergenic
921553035 1:216562340-216562362 ACTCCAGGAAGCCACTCTGAAGG + Intronic
922093699 1:222422721-222422743 GTTTCAGGAAAACAAACTCAGGG + Intergenic
922571200 1:226635609-226635631 TCTGCAGGGAACCACAGTGAAGG + Intronic
922884018 1:229004167-229004189 GCATCAAAACACCACACTGAAGG + Intergenic
1062952224 10:1513363-1513385 GCTTCAGGAAACAGGCCTGATGG - Intronic
1063210452 10:3876117-3876139 TATTCCGGGAACCACACTGATGG - Intergenic
1063336466 10:5220045-5220067 GCTTAAGGAAACCCCTCTAATGG - Intergenic
1064387044 10:14904777-14904799 TCTTCAGGAAACCAATATGATGG - Intronic
1064901875 10:20303873-20303895 GTTGCAGGAAAACACACTCAGGG + Intergenic
1066240380 10:33527707-33527729 GGTTTTGGAAACCAAACTGACGG + Intergenic
1070116147 10:73530703-73530725 GCCTCGGGATACCACAGTGAAGG - Exonic
1071556453 10:86606574-86606596 CTTTCAGAAGACCACACTGAAGG - Intergenic
1072925669 10:99614353-99614375 GCTTCATGACCACACACTGAGGG + Intronic
1075552073 10:123400174-123400196 TCCTGAGGAAACCACAATGAGGG + Intergenic
1080580084 11:33635149-33635171 GCTTCTGGAAACCACATTTCAGG - Intronic
1083229862 11:61309902-61309924 CTTGCAGGAAACCAGACTGAGGG + Exonic
1084651208 11:70490473-70490495 GCTTGGGGAAGCCACAGTGACGG - Intronic
1086102807 11:83118782-83118804 GCTTCAGGAAAATCCACAGAAGG + Intergenic
1089174222 11:116536658-116536680 GCTTCAGGCACCCGCACAGAAGG - Intergenic
1089630340 11:119780307-119780329 GACTCAGGAAACCACACACATGG - Intergenic
1090892102 11:130932785-130932807 GTTTCAGGAAAACACACTCAGGG + Intergenic
1093350854 12:18102076-18102098 GCTTAATGAAGCCACACAGAAGG - Intronic
1094455566 12:30628900-30628922 GTGTCAGGAAAACATACTGATGG + Intergenic
1097000764 12:55874557-55874579 TCTTCTGGAAGCCACAGTGAAGG - Intergenic
1097140273 12:56896855-56896877 GCTTAAGCCAAACACACTGATGG - Intergenic
1098039756 12:66341867-66341889 GCCTCAGAAAACCACAATCATGG - Exonic
1098403104 12:70094628-70094650 GCTTCAGGAAAGAACAGTTATGG + Intergenic
1100692470 12:97053421-97053443 CCTTGAGGGAACCACACTGAGGG + Intergenic
1101959670 12:109239416-109239438 TCTCCAGGAAACCACAATCAAGG - Intronic
1102713774 12:114952404-114952426 GGTGCAGGAGACCACACTGCGGG - Intergenic
1103585191 12:121948005-121948027 GCTGCAGGAGACAGCACTGAGGG - Intronic
1103706006 12:122872983-122873005 GCTCTAGGGAATCACACTGAAGG + Intronic
1103961231 12:124610341-124610363 GCTGCAGGAAAACACCCCGAAGG + Intergenic
1104365197 12:128170501-128170523 GTTGCAGGAATCGACACTGAAGG + Intergenic
1108485177 13:50916693-50916715 GTTTCAGGAAAGCACACCAAGGG - Intronic
1108870320 13:54976625-54976647 TCTTCAGGAAGCCACAGTAAAGG - Intergenic
1111328461 13:86731312-86731334 GCTACAGGCTACCACAATGAGGG + Intergenic
1112918472 13:104580001-104580023 TCCTCAGGAAACCAAACTGAAGG - Intergenic
1114028420 14:18552355-18552377 GCTTCATTAAAGCAAACTGAAGG + Intergenic
1114732880 14:25012869-25012891 GATTCAGGAGACCACACAAAGGG + Intronic
1115246904 14:31304904-31304926 CCTTCAGGAGAGCACACTGCAGG + Exonic
1115455266 14:33594660-33594682 CCCTGAGAAAACCACACTGAAGG + Intronic
1115970744 14:38942233-38942255 GCTTCTGAACACCACACTGGAGG - Intergenic
1117485205 14:56189319-56189341 AATTCAGGAAGCCACACTGATGG + Intronic
1119037249 14:71240983-71241005 GCTCCAGGCAACCACAAAGATGG + Intergenic
1119130707 14:72170021-72170043 GCTTCAAGAAGCCACACTCCTGG - Intronic
1119208302 14:72811013-72811035 GCTTCAGGAAGCTACAATCATGG + Intronic
1120614029 14:86679585-86679607 GCCTCAGGAAACAACAATCATGG + Intergenic
1121016543 14:90552610-90552632 GGTCCAGGAACCCACACAGAAGG + Intronic
1121727208 14:96161368-96161390 GGTTGAGGCAACTACACTGATGG - Intergenic
1125135213 15:36333272-36333294 GCTGCAGGAAAACAAACTCAGGG + Intergenic
1125540847 15:40469186-40469208 TCTTGTGGACACCACACTGAAGG - Intergenic
1129700698 15:77766703-77766725 GCCTCAGGAAACTACAATCATGG - Intronic
1130845607 15:87741589-87741611 GCCTCTGGGAACCGCACTGAGGG + Intergenic
1132463531 16:67210-67232 GCTTCCGGAACCCACAGTGCTGG + Intronic
1132661709 16:1064424-1064446 GCTTCAGGAGTCAACACAGATGG + Intergenic
1137835750 16:51590811-51590833 GCTTCAGCAAACCACCTTGTGGG - Intergenic
1139454877 16:67066160-67066182 GCTCCAGGAACCCACGTTGAGGG + Intronic
1140266594 16:73426438-73426460 GCCTCAGGAAATCACATTAATGG + Intergenic
1141848024 16:86624189-86624211 CCTTCATGTATCCACACTGAGGG - Intergenic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1143338595 17:6191826-6191848 GCATCAGGAAAGCCCACAGAGGG - Intergenic
1148150647 17:45394940-45394962 GCTTCAGCAGCCCACACTGAAGG + Exonic
1149141632 17:53438610-53438632 GCTTGATGAAACCACTCTGAAGG - Intergenic
1149659356 17:58326295-58326317 GCTGCAGGAAACGAACCTGAGGG - Exonic
1150623504 17:66825512-66825534 GCTTCTGGAAGCCTCAATGAAGG - Intergenic
1152058366 17:78050266-78050288 GGTTCTGGCAACCACAATGAAGG + Exonic
1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG + Exonic
1152984194 18:307221-307243 GCTTCAGAATACCACAAAGAAGG + Intergenic
1153123743 18:1764494-1764516 GCTTCAGGAAAACAAGCTCAGGG - Intergenic
1155256784 18:24005080-24005102 CCTTCTGGAAACCTGACTGAGGG - Intronic
1155303730 18:24457783-24457805 GCCTCAGGAAAACACAGTCATGG - Intergenic
1155627400 18:27850541-27850563 GATTAAGGAAACCACACTCAAGG - Intergenic
1156326664 18:36079728-36079750 GCTGCAGCAAACCCCACTCAAGG + Intergenic
1159261421 18:66017235-66017257 GCCTCAGGAAACTACAATCATGG + Intergenic
1160610680 18:80082694-80082716 GTTTCAGAAAGCAACACTGATGG - Intronic
1161272352 19:3397105-3397127 CCCTCAGGAAACCACATTGTTGG + Intronic
1161510502 19:4668193-4668215 GCTTCATAAAACCAAACTCAAGG - Intronic
1162218053 19:9152639-9152661 GTTTCAGGAAAACACTCTCAGGG + Intronic
1166534130 19:43561408-43561430 ACTCCAGGAAACCTCCCTGAGGG + Intronic
1168083710 19:54029529-54029551 GCCTCAGGAAACTACAGTCATGG - Intergenic
925103600 2:1270130-1270152 GTTTCAGGAACCCACCCTGCAGG + Intronic
927762880 2:25775657-25775679 GCCTCAGGAAACAACAATCATGG - Intronic
928774302 2:34739790-34739812 GCTTCAGAAAACAGCATTGAGGG - Intergenic
930019450 2:46992568-46992590 GCCTCAGGAAGCTACGCTGAGGG + Intronic
931246794 2:60498803-60498825 GCTTAAGGAAGCCTCTCTGATGG + Intronic
932541441 2:72658100-72658122 TCTTCATTAAACCATACTGAAGG + Intronic
932820582 2:74896335-74896357 TCTTCTGGAAACCACAGTCAAGG + Intergenic
933499845 2:83097242-83097264 ACTGCAGGAAAACCCACTGATGG - Intergenic
935632532 2:105223885-105223907 TCTCAAGGAAACCACAATGAAGG - Intergenic
936264108 2:110987247-110987269 GCTTCATGATAACCCACTGAAGG - Intronic
936549526 2:113424382-113424404 CATTCAGGAAAACACAGTGAAGG + Intergenic
936571543 2:113620965-113620987 TCTTCAACAACCCACACTGAGGG + Intergenic
939197594 2:138991721-138991743 GCCTCAGGAAACTACAATCAAGG + Intergenic
940235515 2:151507407-151507429 GCTTCAGGAAAAAACAGAGAAGG - Intronic
940995259 2:160142709-160142731 GCCTCAGGAAAAAACACTGTGGG - Intronic
942753022 2:179309258-179309280 GCCTCAGGAAACTACAATCATGG + Intergenic
943409124 2:187523491-187523513 GTTTAAGGCAACCTCACTGAAGG - Intronic
943534559 2:189131679-189131701 GCTTCAGGAAAACACATTGATGG + Intronic
946097547 2:217288586-217288608 GTTGCAGGAAAACACACTCAGGG - Intronic
948253744 2:236551314-236551336 GCCTCAGGAGACCCCACTGGTGG + Intergenic
948756713 2:240163649-240163671 GCTCCTGGCAGCCACACTGATGG + Intergenic
1168953205 20:1816843-1816865 GGCTCAGGAACCAACACTGAGGG - Intergenic
1169007266 20:2218312-2218334 GCCTCAGGAAACTACAATAAGGG + Intergenic
1169204711 20:3733098-3733120 GCTCCAGGGAGCCAAACTGAGGG + Intronic
1169484307 20:6013765-6013787 GCTTAAGGAAAACACACAAATGG - Intronic
1170480916 20:16764110-16764132 GCTTCAGGGACCCACAGAGATGG + Intronic
1173725586 20:45295023-45295045 GCTGCAGGAAAACAAGCTGAGGG + Intronic
1174302082 20:49589729-49589751 GCTGGAGGAACCCACACAGATGG - Intergenic
1175719968 20:61280002-61280024 GCTGCAGGCAACCCCACCGATGG - Intronic
1180452543 22:15479407-15479429 GCTTCATTAAAGCAAACTGAAGG + Intergenic
1180659153 22:17450701-17450723 GGTTGGGGAAACCAGACTGATGG - Intronic
1183217545 22:36490575-36490597 TCTGCAGGCAACCACACTGGGGG + Intronic
1184202163 22:42977833-42977855 GCCTCAGGAAACTACAATCATGG - Intronic
949889589 3:8723835-8723857 GCTGCAGGAAACCACACAGCAGG + Intronic
952251642 3:31662069-31662091 CCCTCTGGAAAGCACACTGATGG - Exonic
952681380 3:36097447-36097469 ACTCTAGAAAACCACACTGATGG - Intergenic
952746580 3:36787555-36787577 GCCTCAGGAACCCAAGCTGAGGG - Intergenic
955153890 3:56396781-56396803 GCTTCAGTGAACCACACAAAGGG - Intronic
955365136 3:58304367-58304389 GCTTCTGGAAACAACACAGTGGG + Intergenic
955417905 3:58709862-58709884 CCTTCTGGAAAACACACTGACGG - Intergenic
956441661 3:69286716-69286738 GCTTGAGAAGACCACAGTGAAGG + Intronic
957590878 3:82196203-82196225 GATTCAGGAAAACACACAGGAGG - Intergenic
957898922 3:86462617-86462639 GATTCAGGAACCAACACTGCTGG - Intergenic
960514258 3:118586192-118586214 GCTACATCAACCCACACTGATGG - Intergenic
961056559 3:123793773-123793795 TCTTGAGGGATCCACACTGAGGG + Exonic
962446416 3:135469842-135469864 GCTGCAGAAAACCAGAGTGATGG + Intergenic
962887706 3:139642744-139642766 GAGTCAGGACACCACAATGAAGG - Intronic
964274671 3:154997216-154997238 TCATCAGGAACCAACACTGACGG - Intergenic
964583100 3:158261810-158261832 GTTTCAGGAAAACAAACTCAGGG + Intronic
965130408 3:164692236-164692258 GCTTCAGGGAACCAGAGAGATGG - Intergenic
965562699 3:170076906-170076928 TCTTCAGTAAACCACAATTATGG - Intronic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
973652467 4:53009886-53009908 GCTACAGGAAACCAGACTGAAGG - Intronic
973777625 4:54257598-54257620 GACTCAAGAAGCCACACTGAGGG - Intronic
974252771 4:59409564-59409586 GCCTCAGGAAACTACAATCATGG - Intergenic
974915911 4:68178311-68178333 GCCTCAGGAAACAACATTCATGG + Intergenic
975441804 4:74419876-74419898 GCTGCAGGAAAACAAACTCAGGG - Intergenic
975717199 4:77216530-77216552 GCCTCAGGAAATCACAGGGATGG + Intronic
978304999 4:107317928-107317950 GCTTTAGTTAACCACTCTGAGGG + Intergenic
980116293 4:128682518-128682540 CCTTCAGGCAAACACGCTGAAGG - Intergenic
980384171 4:132064082-132064104 GATTCAGGAAACCACTTTGCAGG - Intergenic
980410559 4:132413181-132413203 GCCTCAGGAAACTACAATCATGG - Intergenic
981956199 4:150477386-150477408 GCCTCAGGAAACTACAATCATGG + Intronic
985933114 5:3074478-3074500 CTTTCAGGAAACCACACTCTAGG + Intergenic
985979768 5:3452671-3452693 GCTCCGGGAAACCAAGCTGAGGG - Intergenic
986124854 5:4875465-4875487 GCCTCAGGAAGCCACAATCATGG + Intergenic
986507644 5:8469771-8469793 GCCTCAGGAAACTACACTCATGG + Intergenic
986726009 5:10597269-10597291 TCTTGAAGAAAGCACACTGATGG - Intronic
986952099 5:13101185-13101207 GCCTCAGGAAAACAAACTCAGGG + Intergenic
987069229 5:14320421-14320443 GCTTCAGGAAAGCAAACACATGG - Intronic
988018761 5:25596510-25596532 GCTTCAGGAAACTACAATCATGG + Intergenic
988648252 5:33120137-33120159 GTTTTTGGAAAACACACTGAAGG + Intergenic
994518838 5:100803590-100803612 GCCTCTGGGAACCACACAGATGG - Intergenic
996602208 5:125277461-125277483 GCCTCAGGAAACTACAATAAGGG - Intergenic
998859528 5:146428853-146428875 GCTTGAGGAAGCCACAGCGACGG + Intergenic
1000154017 5:158533139-158533161 GCTTCAAGAGATCACAGTGAGGG + Intergenic
1001007313 5:168064431-168064453 GCTCCAGGAAACCAGAATCATGG + Intronic
1002711659 5:181198597-181198619 GCTTCTGGAAAGCACACCCAGGG + Intronic
1007438337 6:41834713-41834735 GCCTCAGGAAACTACAATCATGG - Intronic
1008427366 6:51375202-51375224 TTTTCAGGAGACCACACTAATGG - Intergenic
1010309023 6:74360722-74360744 CCTTCAAGAAACCATAGTGATGG + Intergenic
1012125148 6:95419787-95419809 GCCTCAGGAAACTACAATCATGG + Intergenic
1014371625 6:120616087-120616109 GCTTCAGCAATCCATACTGCTGG + Intergenic
1015490642 6:133821566-133821588 GTTCCAGGAAACCAGACAGAGGG + Intergenic
1016773275 6:147875834-147875856 GTTTCAGGAAAACAAACTCAGGG + Intergenic
1016827270 6:148400120-148400142 GCTACAGAAACCCACTCTGAGGG - Intronic
1016980346 6:149848020-149848042 ACTTCAGAAAACCACACGTAAGG - Intronic
1018533623 6:164795085-164795107 GTTTCAGGAAAGCAAAGTGAAGG - Intergenic
1018869028 6:167767563-167767585 GCTTCAGGAGGACACATTGAAGG - Intergenic
1021467689 7:20964248-20964270 GCATCAGGAAACCAGAATGGTGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1022589117 7:31643920-31643942 CCTTCAGGACACTACAGTGAGGG + Exonic
1022863200 7:34389534-34389556 TCTTCTGGAAGCCACAGTGAAGG + Intergenic
1023793608 7:43772649-43772671 GCCTCAGGAAACAACAATTATGG + Intronic
1025188248 7:56877414-56877436 GCTGCAAGAAGCCACACTGAAGG - Intergenic
1025683678 7:63699506-63699528 GCTGCAAGAAGCCACACTGAAGG + Intergenic
1026143683 7:67727373-67727395 ACTTCAGGAATACACACAGAGGG - Intergenic
1026845848 7:73698828-73698850 CCTGCAGGAAACCCCACTGCAGG - Intronic
1031952513 7:127906771-127906793 TCTTTAGGATACCACACTGAGGG - Intronic
1034863085 7:154616775-154616797 CCTCCAGGGAACCACAGTGACGG + Intronic
1036141984 8:6217123-6217145 GCTTCAGGAAACAATAATTATGG - Intergenic
1039679688 8:39717938-39717960 GCTTCAAGAAAACACACAAATGG + Intronic
1042259839 8:66847042-66847064 GCTTCAGGAAGCCACACTGCAGG + Intronic
1043963337 8:86443710-86443732 GTTAGAGGAAACCTCACTGATGG + Intronic
1049903418 9:192446-192468 CATTCAGGAAAACACAGTGAAGG - Intergenic
1049937663 9:514850-514872 GCTTGATAAAACCACTCTGACGG - Intronic
1052764790 9:32630112-32630134 GCTTCAGGAGAACACAAGGATGG - Exonic
1054480838 9:65662482-65662504 CATTCAGGAAAGCACAGTGAAGG + Intergenic
1057228805 9:93306407-93306429 GCTTCTGGGAGCCCCACTGATGG - Intronic
1059254115 9:112913272-112913294 GCTGCAGGAACCCAATCTGAAGG - Intergenic
1059262732 9:112993979-112994001 GCAGCAGGAAGCCACAGTGATGG + Intergenic
1061257555 9:129461173-129461195 GCTTCAGGGATCCTCTCTGAAGG - Intergenic
1186106829 X:6216368-6216390 TCTTCAGGAACACACACTGCTGG + Intronic
1189277039 X:39794288-39794310 TCTTCAGGAAGGCACACAGATGG + Intergenic
1191054091 X:56224250-56224272 GCTTCAGGAAAGAATACTCAAGG - Intergenic
1192478054 X:71460699-71460721 GCTTCAGGAGAACACAAGGATGG + Exonic
1192691210 X:73366822-73366844 GCTGCAGGAAACCCCACCCAAGG - Intergenic
1194571908 X:95562663-95562685 GCTTCAAGAAAACAAACTCAGGG + Intergenic
1195476905 X:105297485-105297507 GCCTCAGGAAACTACAGTCATGG + Intronic
1195741410 X:108068497-108068519 GCCTCAGGAAACTACAATCATGG + Intronic
1195812629 X:108851342-108851364 GCTGCAGGGAGCCACAGTGATGG - Intergenic
1196226160 X:113169599-113169621 TCTTGAGAAAACCACAATGAAGG - Intergenic
1196651724 X:118174726-118174748 GCTTTGTGAAACAACACTGAAGG + Intergenic
1197368933 X:125601504-125601526 GCCTCAGGAAACTACAATCATGG - Intergenic
1198397748 X:136238606-136238628 GCTTTGGGAAAGCACATTGAGGG + Intronic
1200674526 Y:6134851-6134873 GCACAAGGAAACCACACTAATGG - Intergenic