ID: 1152185537

View in Genome Browser
Species Human (GRCh38)
Location 17:78854446-78854468
Sequence AAGGTGAATTCTCAGATGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152185537_1152185541 23 Left 1152185537 17:78854446-78854468 CCTATCATCTGAGAATTCACCTT 0: 1
1: 0
2: 1
3: 23
4: 203
Right 1152185541 17:78854492-78854514 AACAGGCCATAGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1152185537_1152185539 6 Left 1152185537 17:78854446-78854468 CCTATCATCTGAGAATTCACCTT 0: 1
1: 0
2: 1
3: 23
4: 203
Right 1152185539 17:78854475-78854497 AATAAGATGTCTCTTAAAACAGG 0: 1
1: 0
2: 0
3: 29
4: 257
1152185537_1152185540 20 Left 1152185537 17:78854446-78854468 CCTATCATCTGAGAATTCACCTT 0: 1
1: 0
2: 1
3: 23
4: 203
Right 1152185540 17:78854489-78854511 TAAAACAGGCCATAGTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152185537 Original CRISPR AAGGTGAATTCTCAGATGAT AGG (reversed) Exonic
901484861 1:9552088-9552110 AAGGGTAATACTCAAATGATTGG + Intronic
901877015 1:12172632-12172654 AAGTTGCTTTCTGAGATGATGGG - Intronic
904898770 1:33839197-33839219 AAGGAGAATTCTAGGATGCTTGG + Intronic
906859449 1:49343187-49343209 AAGGTGAATTCTGACAGCATAGG + Intronic
907137374 1:52152416-52152438 ACTTTGAACTCTCAGATGATAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908820350 1:68079038-68079060 AACGTGGTTTCTCAGATGATTGG + Intergenic
908955368 1:69619138-69619160 AAAGTGAAATCACAGATGAAAGG - Intronic
909061432 1:70882872-70882894 AATGTGGTTTCTCAGATGTTTGG + Intronic
910452560 1:87361796-87361818 AAGCTTAATACCCAGATGATGGG + Intergenic
911695662 1:100888295-100888317 AAGGTCAATTGACAGATGAATGG + Intronic
915714750 1:157934272-157934294 AAAGTGAATTCTCTGTTGCTAGG + Intergenic
915750256 1:158200906-158200928 AAGTAGAATTCTAAGTTGATGGG - Intergenic
916595158 1:166235944-166235966 GACATGATTTCTCAGATGATCGG + Intergenic
918587372 1:186203387-186203409 AAGGGGATTTCTCATATGGTTGG - Intergenic
921936053 1:220798254-220798276 AAGGAGAATTCTGAGTTGACAGG + Intronic
923335081 1:232961290-232961312 AAGGTGAAGTCTGAGATGGTGGG + Intronic
1064995508 10:21293723-21293745 AATGTCATTTCCCAGATGATTGG - Intergenic
1066144488 10:32542007-32542029 AACGTGGTTTCTCAGATGATCGG + Intronic
1066202021 10:33150951-33150973 AGGGTTACTTCTCAGAGGATGGG - Intergenic
1067133303 10:43585713-43585735 ATGGTGAATTCTTAGTTGTTTGG + Intergenic
1068002795 10:51356057-51356079 AAGGTGAATTCTATGATGGGAGG - Intronic
1068396930 10:56474268-56474290 AAAGTGAAATCTCAGATGAAGGG - Intergenic
1069700707 10:70423084-70423106 AAGGTCACTTCTCAGATAAGAGG - Exonic
1070256034 10:74813770-74813792 AAGGTGAATTCTTTGAGGAAGGG + Intergenic
1071825553 10:89322331-89322353 GACATGATTTCTCAGATGATTGG - Intronic
1073666897 10:105543851-105543873 AAGGAACATTCTCAGATGACAGG + Intergenic
1078687830 11:13549560-13549582 ATGCTGATTTCTCAGGTGATGGG + Intergenic
1078700486 11:13676689-13676711 AAGCAGAATTCTCAGGAGATAGG + Intronic
1078712026 11:13802365-13802387 AAGTTGGATTCTCAGATCATTGG - Intergenic
1087580746 11:100048736-100048758 AAGGTTTAGTCTCAGAAGATAGG + Intronic
1087597271 11:100270156-100270178 AAGGTGAATGCTCAGAGCATAGG - Intronic
1088723795 11:112617226-112617248 ATGGTGAATTCCTAGATCATAGG + Intergenic
1088970029 11:114765732-114765754 AAAGTGTAATCTCAGAGGATAGG - Intergenic
1091199341 11:133761864-133761886 ATGCTGAAGGCTCAGATGATCGG + Intergenic
1093377053 12:18442509-18442531 GAGGTGAATTCTTAGAAGAGGGG + Intronic
1094037714 12:26088521-26088543 AAGGTGACGTCTAAGATGAATGG - Intergenic
1094044765 12:26155276-26155298 AAGGTGAATTAGAAGATGAGAGG + Intronic
1094643766 12:32301230-32301252 AAGGTTCATTCTCTGATTATAGG - Intronic
1098498465 12:71164238-71164260 AAAGAGAATTCTCAGAGGAATGG - Intronic
1100612833 12:96206029-96206051 ACTGTGAATTCTCAAAGGATTGG + Intronic
1100856552 12:98762484-98762506 AAGGTGTTTTCTGAGATGAAGGG - Intronic
1100969350 12:100050965-100050987 AAAATGAATTCTTAGATGGTGGG - Intronic
1106657767 13:31765259-31765281 ATGGAGAATTCTCTGATGACTGG - Intronic
1106680597 13:32003128-32003150 CAGGTGCATGCACAGATGATGGG - Intergenic
1107108338 13:36670664-36670686 AAAGTGAAATCTCAGATAAAAGG - Intergenic
1108075067 13:46671096-46671118 AAGGTGCATTCCCAGAAGGTAGG - Intronic
1108683975 13:52803125-52803147 ATGGGGAGTTGTCAGATGATTGG + Intergenic
1109934734 13:69265666-69265688 AATGTGGTTTCTTAGATGATTGG + Intergenic
1110043364 13:70795271-70795293 AAGTTGTATTCTGAGATGAGTGG + Intergenic
1111571948 13:90100890-90100912 GAGGTGTACTCTCACATGATAGG - Intergenic
1112131743 13:96532195-96532217 AAGGGGAATTCTTATTTGATGGG + Intronic
1112633842 13:101192958-101192980 AAATTGAATTCTCAGATATTGGG + Intronic
1114398361 14:22387256-22387278 AAGGTGAATCCTCTGATCTTGGG - Intergenic
1117055613 14:51909333-51909355 AAGGTGAATTTTCAAGTGAAAGG + Intronic
1118571002 14:67195384-67195406 AAGGAGAATTCTCAGATGCAAGG + Intronic
1119117163 14:72034857-72034879 AAAGTGAACTCTCAGATAATAGG - Intronic
1119394183 14:74313854-74313876 AAGCTGTAGTCTCAGATGCTTGG + Intronic
1123429835 15:20204709-20204731 GAGGTGACTTCACAGATGACGGG - Intergenic
1123825669 15:24079340-24079362 AATGTGCACTCTCAGATGAATGG - Intergenic
1125815358 15:42579465-42579487 AAGGTCACTTCTCAGATAAGAGG + Intronic
1125904217 15:43375589-43375611 AAGGTGCATTTACAGATAATAGG + Intronic
1126630509 15:50729804-50729826 ACAGTGATTTCACAGATGATAGG + Intronic
1126685897 15:51248625-51248647 AAGGTGAATTCCCAAAGGACAGG + Intronic
1130008415 15:80126200-80126222 AAGTTGAATTGTCAAATCATTGG + Intronic
1131072293 15:89473414-89473436 GAGGTGGCTTCTCAGAGGATGGG - Intronic
1131088895 15:89603955-89603977 AAAGTGAAATCACAGATAATGGG + Intronic
1132121592 15:99180623-99180645 AAGTTGAGTGTTCAGATGATGGG - Intronic
1132941639 16:2511473-2511495 AAGGTGAAGACTCGGTTGATTGG + Intronic
1135259702 16:20970208-20970230 AAGTTGAATGCTCAGATGTTCGG - Intronic
1136854794 16:33646506-33646528 GAGGTGACTTCACAGATGATGGG + Intergenic
1203116371 16_KI270728v1_random:1494983-1495005 GAGGTGACTTCACAGATGATGGG + Intergenic
1142562430 17:818580-818602 ATGGTGGATTCTAATATGATTGG - Intronic
1144924743 17:18795711-18795733 AAAGTGAAACCTCAGATAATGGG - Intronic
1150585517 17:66514362-66514384 AAGGAGAGTTCTCAGATGGGTGG - Intronic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1153311016 18:3677094-3677116 ATGTTGAAATCTCAGAGGATGGG - Intronic
1155608342 18:27633660-27633682 ATGGTGAAATGTCAGATTATCGG + Intergenic
1156046702 18:32885569-32885591 AATGTGAAATCTCAGAGGACAGG + Intergenic
1157061161 18:44292386-44292408 AAGGTTAACTCTGAAATGATGGG + Intergenic
1157735133 18:50040894-50040916 AAGGTCAAATCTCAGATGCGAGG + Intronic
1158743850 18:60174856-60174878 AAGGTAAATTCTGAGATACTGGG + Intergenic
1158838660 18:61359490-61359512 AAAGTGAATTCTTAGAAGATTGG - Intronic
1159162899 18:64667369-64667391 AATGTGCATTCTCACATAATGGG + Intergenic
1162245531 19:9397127-9397149 AAGGTGGAAGCTTAGATGATTGG - Intergenic
1165500148 19:36182556-36182578 AGGATGAATTCTCTGATGTTCGG + Exonic
1165882145 19:39051919-39051941 AAGTACAATTCTGAGATGATAGG + Intergenic
1167053474 19:47094566-47094588 AAGGTGAATTGGAAGATGATGGG - Exonic
1167876348 19:52416630-52416652 AATGTGAATTCTATGGTGATTGG - Exonic
1168700285 19:58434667-58434689 AGAGTGAGTTCTCAGATGGTTGG + Exonic
926282634 2:11462893-11462915 AAAGTGAAACCTCAGATGAGAGG + Intronic
926410250 2:12595305-12595327 AAGGTGAGTTCTCATTTTATAGG + Intergenic
927564942 2:24104048-24104070 AACGTGGTTTTTCAGATGATCGG - Intronic
929686277 2:44037850-44037872 AAGGAGAAATCAAAGATGATGGG - Intergenic
932729812 2:74211347-74211369 CAGGCGAATTCTAAGATGAGGGG - Intronic
934029920 2:88034360-88034382 TTTGTGAATTTTCAGATGATTGG - Intronic
935872138 2:107462506-107462528 GAGGTGGCTTCTCAGAGGATGGG - Intergenic
936340057 2:111623207-111623229 AAGGTGTTTGCACAGATGATGGG - Intergenic
939245211 2:139614471-139614493 AAGAAGAATTTTCAGAGGATAGG - Intergenic
939360218 2:141161985-141162007 AGGATGAAATCTCAGATGAAAGG + Intronic
939782549 2:146466012-146466034 ATTGTGGTTTCTCAGATGATTGG + Intergenic
940816612 2:158304270-158304292 AAAGCAAGTTCTCAGATGATGGG + Intronic
941041889 2:160632712-160632734 AAGGTCAATTCTCCCAAGATAGG + Intergenic
943561387 2:189467371-189467393 AAAGTGAACCCTCAGATAATGGG + Intronic
944119141 2:196221924-196221946 AAGGTAAATTCTCATATTTTGGG + Intronic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
947447772 2:230177712-230177734 AGGGTGAATTCACAGAGGATGGG - Intronic
1170059283 20:12242646-12242668 TAGGTGCATTTTCAGATTATTGG + Intergenic
1170772746 20:19348283-19348305 ACTGAGAATTCTCAGATGATTGG + Intronic
1170899467 20:20446976-20446998 AAACTGATTTCTCAGCTGATTGG + Intronic
1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG + Intronic
1173314226 20:41929390-41929412 CAGGTGTACTCTCAGATGTTGGG + Intergenic
1175815843 20:61882836-61882858 CGGGTGACTTCTCAGAAGATAGG - Intronic
1175918818 20:62440404-62440426 AATGTGCATTCTAAGATGCTTGG + Intergenic
1175968127 20:62669922-62669944 AAAGTGAAACCTCAGATGAGGGG - Intronic
1178147126 21:29752893-29752915 AAGGAGATTTCTTAAATGATTGG + Intronic
1178291126 21:31369382-31369404 AAGGTGAAATATTAGATGGTGGG + Intronic
1178375454 21:32063660-32063682 CAAGTGAATTCCCAGCTGATGGG + Intergenic
1181844820 22:25698592-25698614 AGGGAGAAGTCTCAGATGGTTGG + Intronic
949326903 3:2876209-2876231 TAGGTGAATTCCCAGAGTATGGG - Intronic
951860711 3:27249105-27249127 ATAGTGAATTCTCATGTGATCGG + Intronic
952476406 3:33715298-33715320 AAGGTGACTTAACAGAAGATGGG - Intronic
953080179 3:39609166-39609188 AATGTGGTTTCTCAGAGGATCGG + Intergenic
953097174 3:39789600-39789622 GAGCTGAATTCTCACATGAGAGG - Intergenic
954819152 3:53309909-53309931 TAGGTGAAGACTCAGAAGATTGG - Intronic
957307181 3:78472799-78472821 AATGTGGTTTCTCAGATGATTGG - Intergenic
957779338 3:84798305-84798327 CAGGTAAAATCTCAGAAGATTGG + Intergenic
958030902 3:88108439-88108461 AAAGTGAATCCACAGATGAGGGG - Intronic
958059886 3:88466284-88466306 ATGGTAAATTCTCAGATGGGTGG - Intergenic
961928080 3:130504384-130504406 AAGGTGGTGTCTCAGATGGTGGG - Intergenic
962103028 3:132362581-132362603 ATGGTGAATTCTGCGATGAAGGG + Intronic
964088592 3:152847242-152847264 AAGGTGAATTCTCACAGTCTTGG - Intergenic
964395891 3:156245166-156245188 AAGGTAAATTCTAAGATGGCAGG - Intronic
965829193 3:172764421-172764443 AAAGGGAATGCTCAGCTGATGGG - Exonic
971059157 4:22947717-22947739 CAGGTGTCTTCCCAGATGATGGG + Intergenic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
972411375 4:38798739-38798761 AAAGTGAATTTTTAGTTGATAGG - Exonic
973863738 4:55091155-55091177 AAGGAGAATTCTTAAATCATTGG + Intronic
974012618 4:56620858-56620880 AAGGGGCACTCTCAGATGCTAGG - Intergenic
974440819 4:61914677-61914699 AATGTGAATATTCAGATCATTGG - Intronic
974546012 4:63307621-63307643 AATGTGACTTCACAGATGATTGG - Intergenic
974967753 4:68783795-68783817 AATGTGAATTCCCTGTTGATAGG + Intergenic
975476642 4:74831161-74831183 GAGGTGGATTCTGAGATTATTGG + Intergenic
977720545 4:100235612-100235634 AAGGTGAACTCTTAAATAATGGG - Intergenic
978982858 4:114970908-114970930 AAGGGTAATTCTCAAATAATTGG + Intronic
979646910 4:123080205-123080227 AAGGTTAGTTCCCACATGATGGG + Intronic
980523311 4:133958746-133958768 TAAGTGAATTCTCAAAAGATCGG - Intergenic
980545179 4:134252023-134252045 AAGGTGAATTGTTAGGTTATTGG + Intergenic
980662262 4:135877674-135877696 AAAGTGTCTTCTCAGATGACAGG - Intergenic
980890179 4:138806579-138806601 ACAGTGTATTCTCAGATGTTTGG + Intergenic
981429561 4:144644767-144644789 AAGCTGATTTCCCAGAAGATGGG - Intergenic
982978323 4:162096313-162096335 AAGTTAAATTCTTGGATGATTGG - Intronic
983895229 4:173074283-173074305 AAGGTGAATTTTCACAACATAGG + Intergenic
984831752 4:183982216-183982238 AAAGTCAATTCTCATAGGATTGG - Intronic
986089249 5:4487925-4487947 ATGGGGAATCCTCAGGTGATGGG - Intergenic
986877719 5:12131874-12131896 AATGTGTTTTCTCAGATGATTGG - Intergenic
987829756 5:23080317-23080339 AATTTGAATTCTCAAATGGTAGG - Intergenic
988728563 5:33947443-33947465 AAGGTGAATCTTCAGAAGAAAGG - Intronic
989722276 5:44543396-44543418 CAGGTAAATTCTCAGATGTTGGG - Intergenic
991047065 5:62233664-62233686 GAGGTGACTTCACAGATGACGGG - Intergenic
992012407 5:72541769-72541791 AAGGTGATTGTTCAGGTGATTGG - Intergenic
992057509 5:73005698-73005720 AAGGTAAATTATAAGAAGATAGG - Intronic
994804457 5:104426287-104426309 CAGATGAAGTCTCAGATTATGGG - Intergenic
996142568 5:119929659-119929681 AATGTGGTTTCTCAGATGACTGG + Intergenic
996448922 5:123595082-123595104 AAGGTGAGCTCTCAAATGGTGGG - Exonic
996846644 5:127906410-127906432 AATGTCCATTGTCAGATGATTGG - Intergenic
998300824 5:141017912-141017934 AAGGAGAATTCTCAGAAAAAAGG + Intergenic
998437741 5:142127523-142127545 CATCTGAATTCTCAGGTGATTGG + Intronic
1001003214 5:168027240-168027262 AAGGTCAACTCTGAGATCATTGG + Intronic
1001317451 5:170653983-170654005 AAGATGAATTGCCAGATGAAGGG - Intronic
1003258136 6:4491639-4491661 AAGATGACATCACAGATGATTGG + Intergenic
1003885146 6:10514780-10514802 AAAGTAAATTGTCAGATGGTGGG - Intronic
1005764252 6:28995352-28995374 AGTGTGAATTCTTCGATGATTGG + Exonic
1006082655 6:31576399-31576421 AAGGTGAATACACAGATGAATGG + Intronic
1007585237 6:42985067-42985089 AAGGTGCAGTTTCAGATGAGGGG - Intronic
1008833238 6:55794814-55794836 AATGTGAATTCTCAAATGAATGG + Intronic
1008916218 6:56790215-56790237 AATGAGAAATCACAGATGATTGG - Intronic
1014073752 6:117213985-117214007 AAGGGGAAATCTAAGATCATTGG - Intergenic
1014282736 6:119459739-119459761 AAGGTGAATTCAAAGTTGAGTGG - Intergenic
1014432452 6:121387362-121387384 AAAGGGAATCCTCAGATGAAGGG + Intergenic
1014929018 6:127310928-127310950 TCGGTGAAGGCTCAGATGATTGG + Intronic
1015981263 6:138841972-138841994 AAGCTGAATTCTCAGAATCTAGG + Intronic
1016944642 6:149518286-149518308 AAATTGAATTCTCATCTGATAGG - Intronic
1017777248 6:157689767-157689789 AAGGCGTCTTCTCAGATGAAGGG + Intergenic
1018079503 6:160246852-160246874 ATGGTGAATATGCAGATGATGGG + Intronic
1020176428 7:5885946-5885968 AAAGAAAATTGTCAGATGATGGG - Intronic
1021783603 7:24130630-24130652 CAGGTGTATTCTTAGATTATAGG + Intergenic
1021823109 7:24517751-24517773 AATGTGGAGTCTCAGAAGATTGG - Intergenic
1022666879 7:32419511-32419533 CAGGTTTATTCTCAGATGACTGG - Intergenic
1024433139 7:49314374-49314396 AATTTGAATTTTCAGTTGATAGG - Intergenic
1027753129 7:82177162-82177184 AAGGTGAATTCTGGGGTGGTAGG - Intronic
1028107492 7:86897339-86897361 CAGCTGAACTCTCAGATGCTAGG - Intronic
1029082398 7:97985079-97985101 AAAGAAAATTGTCAGATGATGGG + Intronic
1029807059 7:103009303-103009325 AATGTGGTTTCTCAGATGGTTGG - Intronic
1033849581 7:145479177-145479199 AAGGTGAATACATAGATGTTAGG - Intergenic
1034727479 7:153351198-153351220 AAGGTGAAAGCTTAGATTATTGG + Intergenic
1036523403 8:9513279-9513301 AAGGTGGATTTGCAGATGAACGG - Intergenic
1038859322 8:31369299-31369321 AAGGTGGATACTTAGCTGATTGG + Intergenic
1039450364 8:37669133-37669155 AAAGTAAATTGTAAGATGATGGG + Intergenic
1042563187 8:70088827-70088849 AAGGTGAATTCAGAGGTGAGAGG + Intergenic
1043114103 8:76227169-76227191 ATGCTGAATTCTAAGATGCTAGG + Intergenic
1046209561 8:111051392-111051414 AAGGTGAAATCTTAGAGTATTGG + Intergenic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1049630318 8:143650960-143650982 AGTGTGAATTCTCTGATGCTGGG - Exonic
1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG + Intergenic
1050403174 9:5278875-5278897 AAAGTGAATGCTTCGATGATTGG - Intergenic
1050960948 9:11730160-11730182 AAGGAGCATTCTGAGATGCTAGG + Intergenic
1054567231 9:66773039-66773061 AAAGTGAATACTCAGAGGATGGG - Intergenic
1055084271 9:72298515-72298537 AAAGTGAAATCACAGATAATGGG + Intergenic
1055335658 9:75230607-75230629 AAGGTCAATGCTCTGATGAATGG + Intergenic
1055388429 9:75791092-75791114 GGGGTGAATACTCAGGTGATGGG - Intergenic
1055573318 9:77639152-77639174 AAGGTAAGTGCTCAGATGCTGGG - Intronic
1056497944 9:87178553-87178575 AAGATGATTTCTCAGAGGAAGGG - Intergenic
1056719705 9:89061149-89061171 GAGGTGAATTTTCTGATGGTTGG - Intronic
1056877515 9:90349098-90349120 AGTGTGGTTTCTCAGATGATTGG - Intergenic
1057539711 9:95955445-95955467 AAGGAAAATTCTGGGATGATGGG - Intronic
1058000015 9:99855718-99855740 AAGGTGAATTCCCAGAGAAAGGG + Intronic
1058938366 9:109790365-109790387 AAAGTGAATACTTAGATGACTGG - Intronic
1059109540 9:111542299-111542321 AGTGTGAATTCTCCGATGTTTGG - Exonic
1061651338 9:132052899-132052921 AAGGTGGATTAACAGACGATTGG - Intronic
1187407694 X:19018662-19018684 AAGGTGACATCTCAGATCACTGG + Intronic
1188857730 X:35218276-35218298 AAGGGAAATTTTGAGATGATGGG + Intergenic
1193043936 X:77032809-77032831 GATGTGGTTTCTCAGATGATTGG - Intergenic
1193411576 X:81169565-81169587 AAGATGAGTTCAAAGATGATTGG + Intronic
1195422715 X:104693643-104693665 AAAGTGAATTCTCTGAAAATAGG - Intronic
1195948730 X:110244068-110244090 AAGGTTCCTTCTTAGATGATGGG - Intronic
1198887513 X:141355389-141355411 AATGAGAAATCTGAGATGATGGG + Intergenic
1200455387 Y:3384768-3384790 AAGGTGGAAGCTTAGATGATTGG + Intergenic