ID: 1152189877

View in Genome Browser
Species Human (GRCh38)
Location 17:78881933-78881955
Sequence TGCCAGGTTGACCAGCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152189877 Original CRISPR TGCCAGGTTGACCAGCCATA TGG (reversed) Intronic
900098121 1:948635-948657 AGCCAGGGTGACCAGGCATGGGG - Intronic
902795089 1:18795771-18795793 TGCCAGGGGGACCAGCACTATGG + Intergenic
905279765 1:36841647-36841669 TGCCAGGCTGCCCAGCCCTGTGG + Intronic
909140137 1:71854124-71854146 TGCCTGGTTGACAAGGTATAGGG - Intronic
910118222 1:83756266-83756288 TGCCAAGGTGACCAGGCATTTGG + Intergenic
910987758 1:93022951-93022973 AGCCACCTTGCCCAGCCATAGGG - Intergenic
913088191 1:115458253-115458275 TGCCAGGATGAGCAGCTATTGGG + Intergenic
915802033 1:158804015-158804037 TTCAAGGTTGACCAGCAATGAGG + Intergenic
920673786 1:208024796-208024818 TGCCAGTCTGAGCAGCCATGCGG + Exonic
1064005672 10:11697002-11697024 TGTCAAGTTGACCATCCACAAGG - Intergenic
1064625496 10:17257495-17257517 TGCTTGGTTTACCAGCCAGAGGG + Intergenic
1066104961 10:32148354-32148376 TGCTAGGATTACCAGCCAAAGGG - Intergenic
1072581096 10:96740766-96740788 TCCCAGGTTGGCCAGCCCTCTGG + Intergenic
1075287388 10:121198859-121198881 TGCCATGTTGGCCAGCCACTGGG + Intergenic
1076324145 10:129608155-129608177 TGCCACGTTGACTTGCAATATGG + Intronic
1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG + Intergenic
1090225107 11:125065562-125065584 TTCCAGGTTTACAAGCCAAAAGG - Intronic
1090608444 11:128449192-128449214 TCCCAGTTTGAGCAGCAATATGG + Intergenic
1093461335 12:19409575-19409597 TGCCAAGTTCACCAGCCGTGGGG + Intronic
1093650688 12:21642006-21642028 TGCCAAGTTTTTCAGCCATAAGG + Exonic
1101483936 12:105131946-105131968 TGACAGTTTGCCCAGCAATATGG + Intronic
1101991351 12:109487900-109487922 TTCCAGGTGGACCTGCTATAGGG + Intronic
1102613077 12:114129592-114129614 TGCCATTTTGACCAGAAATAAGG + Intergenic
1103126376 12:118426233-118426255 GACCATGTTGACCAGCCTTATGG + Intergenic
1106343846 13:28857065-28857087 TGCCAGGTAAACCAGGCAAATGG - Intronic
1106705581 13:32275644-32275666 TGCCAGGTTGCCCAGTCGGATGG + Intronic
1107811862 13:44208138-44208160 TGCCATGTTGAGCAGCTCTATGG - Intergenic
1109761111 13:66830261-66830283 GTCCAGGTTGAACAGTCATATGG - Intronic
1111433161 13:88170778-88170800 TGCCAGGTTCACCTGCAAAAGGG - Intergenic
1113536934 13:111075807-111075829 TGCCAGGTTGGCCAGTCCTTGGG + Intergenic
1118761560 14:68883253-68883275 TGCTAATTTGACCAGCCCTAAGG - Intronic
1118826836 14:69391355-69391377 TGCTAGGTTGGCCAGGCATGGGG + Intronic
1119770836 14:77219809-77219831 TGCCAGGTACACCAGGCATCTGG - Intronic
1120668568 14:87336814-87336836 TGCCAGGATCACCAGACATGGGG + Intergenic
1125615113 15:41004222-41004244 TGCCTGTTTGACCAACAATAAGG - Intronic
1128314304 15:66650655-66650677 TGCCTGGGTCACCAGCCATCTGG + Intronic
1130024686 15:80260944-80260966 TGCCAGCTGGACCAGCCTCAGGG + Intergenic
1132125482 15:99220416-99220438 TGCCAGTTTGTCCTGCCATCTGG - Intronic
1133684660 16:8154741-8154763 TGCCAGGATGACCAGACCTTGGG - Intergenic
1135558189 16:23454460-23454482 TTCCAGGTTGGCCTGCCATTGGG + Intergenic
1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG + Intergenic
1152189877 17:78881933-78881955 TGCCAGGTTGACCAGCCATATGG - Intronic
1152327850 17:79651896-79651918 TGCCATGTCAAGCAGCCATATGG + Intergenic
1153252672 18:3138282-3138304 TGACAGGTTGACCAGCTGTCAGG + Intronic
1167355976 19:49004372-49004394 TGCCCGGCTGGCCAGCAATAAGG - Exonic
928368905 2:30724619-30724641 TGCCAGGGTGTCCAGCCTTCTGG - Intronic
932469170 2:71942753-71942775 TGACAAGTTGACCTGCTATAGGG + Intergenic
938235838 2:129706463-129706485 TGCCAGGCAGACCAGGCAGATGG - Intergenic
942092707 2:172509436-172509458 TGGCAGATTGTCCAGCCATCGGG - Intergenic
942950092 2:181712309-181712331 TGCCTGGATGACCAGGCAGAGGG + Intergenic
945274741 2:207977011-207977033 TGCCAGGCTGAAAAGCCATAAGG + Exonic
946140178 2:217683586-217683608 TGCCAGATTCACCACCCATGTGG + Intronic
947835553 2:233172302-233172324 TGCCAGGATGACAGGCCACAGGG + Intronic
1174217605 20:48929088-48929110 TGCCAGTTTCACCAGGCTTAGGG + Intronic
1180076152 21:45464141-45464163 TTCCAGGTTGCCCAGCCCTCGGG + Intronic
1181622735 22:24102153-24102175 TGCCAGGCTGGCCAACCACAGGG - Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
953545521 3:43861424-43861446 AGCCTGGTTGGCCAGCCATTGGG - Intergenic
953804766 3:46058848-46058870 AGCCATGATGACCGGCCATAGGG + Intergenic
953991352 3:47485896-47485918 TGCCAGGATGAGAAGCCATGTGG + Intergenic
954932954 3:54299921-54299943 TCCCACGTTCATCAGCCATAAGG - Intronic
961605939 3:128095419-128095441 TGCCAGGCATACCAGCCATAAGG + Intronic
966237104 3:177714127-177714149 TGACAGCTTGACCAGACATCTGG + Intergenic
966941516 3:184750835-184750857 AGCACGGTTGACCAGCCAGAAGG - Intergenic
967367270 3:188701491-188701513 GGCCAGGCTGACCTGCCTTACGG - Intronic
976936169 4:90637287-90637309 TGCCATGTTGACCAGCGAAAAGG - Intronic
977014561 4:91677023-91677045 TGTAAGGTTTCCCAGCCATATGG + Intergenic
978138199 4:105289144-105289166 TGCCAGGTAGGCCAGTCTTAAGG + Intergenic
978506123 4:109458404-109458426 TGTCAGGATGCCCAGCAATAAGG - Intronic
986448728 5:7846200-7846222 CTCCATGTTGACCAGCCATGTGG - Intronic
992866859 5:80965966-80965988 AGTCAGATTGACCAACCATATGG + Intronic
999689058 5:154129720-154129742 TTCCAGGTTGACCAAGCACACGG + Intronic
1003090285 6:3096181-3096203 TACCAGGCTGACCAGAAATAGGG - Intronic
1007645442 6:43376785-43376807 TGCCATGTTGAGCAACCCTATGG + Intergenic
1007782490 6:44262647-44262669 TGCCAGGTGGACCAGCCTAGGGG + Exonic
1016842745 6:148540868-148540890 TACCAGGTAGACCATCCATCAGG + Intronic
1017384055 6:153861968-153861990 TGCCAGGTGGACCAGTCATCAGG - Intergenic
1020261896 7:6535544-6535566 TGAGAGGTTGAACAGCCAAAGGG - Intronic
1023270543 7:38456882-38456904 TGCCAGGTTGACCAGTCTTTGGG - Intronic
1023774558 7:43592375-43592397 TACCAAATTGAACAGCCATAGGG + Intronic
1027977290 7:85174873-85174895 AGCCATGTGGACCAGGCATATGG - Intronic
1034380864 7:150691266-150691288 TGCCATGTGGACCAGCGAAATGG + Intronic
1037020654 8:13966209-13966231 TGCCAACTTGACTAGCCATAGGG - Intergenic
1042996165 8:74701825-74701847 TTCCAGGTTAACCAGAGATAAGG - Intronic
1043830476 8:84982632-84982654 AGCCAGGTAGACCAGCCAGGTGG - Intergenic
1048179837 8:132184594-132184616 TGCCAGGTTTAACAGCATTAAGG - Intronic
1048311163 8:133323425-133323447 TGCCAGGTGGCCCAGCCCGACGG + Intergenic
1055719081 9:79151476-79151498 TGCCAGGTTTACCAAGCATTTGG - Intergenic
1056446699 9:86673448-86673470 TCCCAGGATGATCAGCCCTAAGG - Intergenic
1061279068 9:129586709-129586731 TGCCAGGTTCAGCAGGCAGAGGG - Intergenic
1062030685 9:134360628-134360650 CGCCAGGCTGAGCAGCCAAAGGG - Intronic
1192986718 X:76407569-76407591 TGACAGTTTGACCAGCCTAATGG + Intergenic
1197782766 X:130173401-130173423 TGGCAGTTTGACCAGCAAGAAGG - Intronic
1200052975 X:153444577-153444599 TGGCTGCCTGACCAGCCATACGG - Intergenic