ID: 1152190235

View in Genome Browser
Species Human (GRCh38)
Location 17:78883653-78883675
Sequence GCACGTGAGCTGCTGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152190228_1152190235 4 Left 1152190228 17:78883626-78883648 CCCTCCCCGGCTGCCTGAGATTC 0: 1
1: 0
2: 2
3: 23
4: 203
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190227_1152190235 16 Left 1152190227 17:78883614-78883636 CCAGGGAATGCTCCCTCCCCGGC 0: 1
1: 0
2: 2
3: 15
4: 248
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190230_1152190235 0 Left 1152190230 17:78883630-78883652 CCCCGGCTGCCTGAGATTCTAGT 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190225_1152190235 17 Left 1152190225 17:78883613-78883635 CCCAGGGAATGCTCCCTCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 526
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190229_1152190235 3 Left 1152190229 17:78883627-78883649 CCTCCCCGGCTGCCTGAGATTCT 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190222_1152190235 25 Left 1152190222 17:78883605-78883627 CCTGCCGCCCCAGGGAATGCTCC 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190223_1152190235 21 Left 1152190223 17:78883609-78883631 CCGCCCCAGGGAATGCTCCCTCC 0: 1
1: 1
2: 1
3: 46
4: 339
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190231_1152190235 -1 Left 1152190231 17:78883631-78883653 CCCGGCTGCCTGAGATTCTAGTG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190232_1152190235 -2 Left 1152190232 17:78883632-78883654 CCGGCTGCCTGAGATTCTAGTGC 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190224_1152190235 18 Left 1152190224 17:78883612-78883634 CCCCAGGGAATGCTCCCTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 505
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190221_1152190235 26 Left 1152190221 17:78883604-78883626 CCCTGCCGCCCCAGGGAATGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1152190233_1152190235 -9 Left 1152190233 17:78883639-78883661 CCTGAGATTCTAGTGCACGTGAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152190235 Original CRISPR GCACGTGAGCTGCTGGCCAC TGG Intronic
900250452 1:1666072-1666094 TCAGCCGAGCTGCTGGCCACGGG - Intronic
903337780 1:22636534-22636556 CCTGGTGAGCTTCTGGCCACTGG + Exonic
907405634 1:54251894-54251916 GCTCCGGAGCTGCTGGCCATGGG + Intronic
907962759 1:59298249-59298271 GCTCTTGACCTGATGGCCACTGG + Intronic
911935002 1:103959654-103959676 GCAGAGGTGCTGCTGGCCACGGG - Intergenic
912520084 1:110239237-110239259 GAAAGTGAGCTGCTGGTCTCAGG - Intronic
915043201 1:152985517-152985539 GCCCTTGAGGAGCTGGCCACTGG + Intergenic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
920107064 1:203561260-203561282 GCAGGTGAGCAGCTGGCAATAGG + Intergenic
923076370 1:230612417-230612439 GCAGGTGATCTGCAGGCAACCGG + Intergenic
1062819764 10:525931-525953 CCAGGTGAGCTGCTGCCCAGAGG + Intronic
1063127039 10:3144341-3144363 CCACCAGAGCTGCTGGGCACAGG + Exonic
1067434690 10:46268718-46268740 GAGAGTGAGCTTCTGGCCACAGG + Intergenic
1067817827 10:49496054-49496076 GCTGGTGGGCTGCTAGCCACAGG - Intronic
1069056200 10:63847420-63847442 GCACGTGACCTGTTGGGAACAGG + Intergenic
1074441824 10:113484439-113484461 GCACGTGGGCTGTTACCCACAGG + Intergenic
1074893079 10:117751405-117751427 GCTGGTGAACTGCTGCCCACAGG + Intergenic
1075462195 10:122624261-122624283 GCACTTGAATTGCTGGTCACTGG + Intronic
1075830008 10:125400541-125400563 GGGAGAGAGCTGCTGGCCACTGG - Intergenic
1077415419 11:2422363-2422385 GCATGGGAGCTGCTGGGCATTGG + Intronic
1080295913 11:30727232-30727254 GCACGTGGCCTGCTGGCTATGGG + Intergenic
1081620590 11:44617042-44617064 GCACGCCCCCTGCTGGCCACTGG + Intronic
1082173103 11:49030115-49030137 GCACTTGAACTTCTGGCCTCAGG - Intronic
1083538015 11:63490050-63490072 GCTTGGGACCTGCTGGCCACAGG - Intronic
1083890575 11:65593736-65593758 GCACGTGGGCGGCTGAGCACAGG + Exonic
1084190333 11:67495751-67495773 GCAGGAGTGCAGCTGGCCACTGG - Intronic
1089134067 11:116235352-116235374 CCAGGTGAGCTGCAGGCCTCAGG - Intergenic
1089602332 11:119623658-119623680 GCAGGTGGGCAGCTGGCCCCAGG + Intronic
1089852370 11:121510811-121510833 GCACAAGAGCTGTTAGCCACTGG + Intronic
1093005420 12:14045976-14045998 GGAAGTGAGCTGCTGGGCAAGGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1103342486 12:120228531-120228553 GCCCGTCAGCTTCTTGCCACTGG + Intronic
1104583521 12:130029086-130029108 GCACGTGGGCTGCTGGCTGAAGG + Intergenic
1105522760 13:21145733-21145755 GAACTTGAGCTCCTGGCCTCAGG + Intronic
1107255928 13:38426975-38426997 GCACGGGACCTGCTGGGCCCTGG - Intergenic
1113041219 13:106105801-106105823 GCATGTGACCTGCAGGACACGGG - Intergenic
1113807739 13:113119383-113119405 GCACGTGATCTGCTGGCCTCAGG + Exonic
1114146772 14:19986133-19986155 GCAGGTAAGCTGCTGCCCAGTGG - Intergenic
1115236906 14:31216699-31216721 GCTCTTGAGCTCCTGGCCTCAGG + Intergenic
1119993812 14:79229700-79229722 CCAAGTGAGCTGCTCTCCACTGG - Intronic
1121275811 14:92666901-92666923 CCACGTGAGCTTCTGGAAACAGG + Intronic
1121323497 14:93006516-93006538 GCCTGTGACCTGCAGGCCACAGG - Intronic
1122984183 14:105204766-105204788 CCACGTGGGCTGCTGGCTGCTGG - Intergenic
1129209657 15:74060324-74060346 GCACCTGTGGTGGTGGCCACAGG + Intergenic
1129256233 15:74335643-74335665 GCTGCTGAGCTTCTGGCCACGGG - Intronic
1132639111 16:969669-969691 GCTCCGGAGCTGCTGGCCCCGGG - Intronic
1139551418 16:67675128-67675150 GCACCTGGGCTCCTTGCCACAGG - Exonic
1139921115 16:70461250-70461272 GCAAGTAAGCTGCTCACCACTGG - Intronic
1140020604 16:71234738-71234760 GCCCCATAGCTGCTGGCCACTGG - Intergenic
1141550303 16:84802534-84802556 GGAGGTGGGCAGCTGGCCACTGG + Intergenic
1141704828 16:85658950-85658972 CCACGTGTGCAGCCGGCCACAGG - Intronic
1142427152 16:90007263-90007285 CCATGGGAGCAGCTGGCCACCGG + Intronic
1148044179 17:44732346-44732368 TCATGTGAGCTTCTGGTCACCGG + Intronic
1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG + Intronic
1152933522 17:83122740-83122762 GGAAGGGACCTGCTGGCCACAGG + Intergenic
1153051360 18:905736-905758 GCCAGTGAGCTTCTGGCCGCTGG + Intronic
1153550761 18:6259080-6259102 GCAGGTGTGCACCTGGCCACAGG + Intronic
1153555298 18:6306645-6306667 GTACTTGAGATGGTGGCCACTGG - Intronic
1154463893 18:14623698-14623720 GCAGGTAAGCTGCTGCCCATTGG - Intergenic
1158701834 18:59755212-59755234 GTATGTGAGCTGGTGGCCACAGG - Intergenic
1163645803 19:18488422-18488444 GCACATGCCCTGCTGGTCACAGG - Intronic
1164283489 19:23789910-23789932 TCAGGTGATCTGCTGGCCTCAGG + Intronic
1168094952 19:54109223-54109245 GCACGGTAGCCGCTGGCCACAGG - Intronic
925269771 2:2595673-2595695 GCTCTTGAGCTGCTGACCTCAGG - Intergenic
931667365 2:64618933-64618955 GCACGTGGCCTGCAGGCCACAGG - Intergenic
935581046 2:104756062-104756084 GCTGGTGAGCTGTGGGCCACAGG - Intergenic
936090878 2:109500712-109500734 GCAAGTGATCCGCTGGCCTCAGG - Intronic
937095198 2:119230814-119230836 GCACGCCAGCTCTTGGCCACAGG - Exonic
937129297 2:119495417-119495439 GTACGTGAGCTGTGTGCCACTGG - Intronic
937346518 2:121129558-121129580 GCAAGGGAGCTGTTGTCCACAGG - Intergenic
938246089 2:129779112-129779134 GCAGGGGTGCTGCTGGGCACAGG + Intergenic
941379011 2:164768330-164768352 GCATGTGGCCTGCAGGCCACAGG - Intronic
942070151 2:172308843-172308865 GCACTGGAGCTGCTGGCCTGGGG - Intergenic
942700689 2:178706184-178706206 GGACTTGAGCATCTGGCCACAGG - Intronic
947533041 2:230924811-230924833 GCACGTGAGCTACATGCCCCGGG + Intronic
948012165 2:234657545-234657567 ACTCGGGAGCTGCTGGCCGCAGG + Intergenic
1169140104 20:3222964-3222986 GCACTTGAACAGCTGGCCAGGGG - Intronic
1171255094 20:23684495-23684517 GCACATGGGGTGCTGGCCTCAGG + Intergenic
1171262444 20:23746420-23746442 GCACATGGGGTGCTGGCCTCAGG + Intergenic
1171271537 20:23822140-23822162 GCACATGGGGTGCTGGCCTCAGG + Intergenic
1172488954 20:35318725-35318747 ACACGTGATCTGCAGGCAACAGG + Intronic
1173891297 20:46513274-46513296 GCTCCTGACCTGCAGGCCACGGG - Intronic
1176044767 20:63086834-63086856 CCACGTGAGCTGCAGGGCCCCGG - Intergenic
1176810638 21:13534675-13534697 GCAGGTAAGCTGCTGCCCATTGG + Intergenic
1178828445 21:36034987-36035009 GAACGGGACCTGCTGGCCTCAGG - Exonic
1179238367 21:39566995-39567017 ACACGGTAGCTGCTAGCCACAGG - Intronic
1180020524 21:45122594-45122616 GAAGATGAGCTGCTGGCCCCTGG + Intronic
1180983182 22:19888969-19888991 GCACCTGCCCTGCTGGCCTCAGG + Intronic
1181147275 22:20858289-20858311 GGATGTGAGCTGCTGGCCCAGGG - Intronic
1182418097 22:30234293-30234315 TCAAGTGATCTGCTGGACACTGG - Intergenic
1183647419 22:39134613-39134635 GCACCTGAGCTGGTGGACAAGGG - Exonic
1184089592 22:42285179-42285201 GCAGCTGGGCTGCTGACCACTGG + Intronic
1185208646 22:49554419-49554441 GTACGTCAGGTGCTGGCCAGGGG + Intronic
949894677 3:8760364-8760386 GCATGTCAGCAGCTGGCCGCAGG + Intronic
950505764 3:13393561-13393583 GCCTGCCAGCTGCTGGCCACTGG + Intronic
950902687 3:16512365-16512387 GCACATGAGTTGCTGGAAACTGG + Intronic
953413511 3:42702814-42702836 GCTGCAGAGCTGCTGGCCACAGG + Exonic
958810036 3:98850426-98850448 GCATGTGGCCTGCAGGCCACAGG + Intronic
961051833 3:123753090-123753112 GCACGGTAGCCACTGGCCACAGG + Intronic
968279654 3:197466751-197466773 GCACGTGGGCAGCTGGTCATGGG + Intergenic
968328470 3:197842848-197842870 TCAGGTGATCTGCTGGCCTCGGG - Intronic
968655965 4:1778568-1778590 GCACGTGAGGTGGAGGCCAGCGG - Intergenic
968810472 4:2797496-2797518 GCAGGTGAGCTGCTACCCATGGG - Intronic
968919221 4:3514081-3514103 GGACCTGAGCTCCTGCCCACGGG + Intronic
969315867 4:6381040-6381062 ACGGGAGAGCTGCTGGCCACAGG - Exonic
969942744 4:10750864-10750886 ACTGGTGAGCTGCTGGCCAGTGG + Intergenic
974420251 4:61663424-61663446 GCACCTGTGCTGCTGCCCAAAGG + Intronic
975094483 4:70442385-70442407 GCAGGTGGGCTGCAGGCCAGGGG - Intronic
975823915 4:78299920-78299942 GCACGTTCTCAGCTGGCCACAGG - Intronic
979014721 4:115419018-115419040 GCACGTGAGCCCGTGGCCATTGG - Intergenic
981336361 4:143573240-143573262 GCACAGGAGCTGCTGTCCCCTGG - Intergenic
982105573 4:152009102-152009124 GCAGGCAAGCTGCTGTCCACAGG - Intergenic
984714288 4:182912536-182912558 GCTCCTGAGCTCCTGGGCACTGG - Intronic
985575933 5:673519-673541 CCACCTGAGCTGCTGCCCGCAGG + Intronic
986494334 5:8327389-8327411 GCACGAGGGCATCTGGCCACAGG + Intergenic
987668168 5:20972615-20972637 CCAGCTGAGCCGCTGGCCACTGG - Intergenic
992240433 5:74764406-74764428 GCATGTGGCCTGCAGGCCACGGG - Intronic
995152336 5:108863395-108863417 ACACGTGAGCTGCTGCACCCAGG + Intronic
996557848 5:124797388-124797410 GCACTTGAACTCCTGGCCTCAGG + Intergenic
998038784 5:138937763-138937785 GCATGGGTGCTGCTAGCCACAGG - Intergenic
1002254625 5:177949957-177949979 ACACCTGAGCTGCTGTCCACAGG - Intergenic
1002483367 5:179517855-179517877 ACACCTGAGCTGCTGTCCACAGG + Intergenic
1005580005 6:27224787-27224809 CCACCTCAGCTGCTGGCCAAAGG - Intergenic
1006332995 6:33405500-33405522 GTCCGGGACCTGCTGGCCACTGG + Exonic
1012306127 6:97660044-97660066 GCATGTGGCCTGCAGGCCACAGG + Intergenic
1014671583 6:124311409-124311431 GCATGTGAGCGCATGGCCACAGG - Intronic
1014817774 6:125953834-125953856 GCAGAGGGGCTGCTGGCCACAGG + Intergenic
1016356747 6:143226894-143226916 GCATGTCGGCTGCGGGCCACAGG - Intronic
1019023306 6:168937322-168937344 CCACCTGAGCAGCTGGCCTCCGG + Intergenic
1020110096 7:5443148-5443170 AGACGTGAGCTTCTGGCCCCAGG + Intronic
1024518453 7:50282181-50282203 GCACGTCTGCTGCTGTCCTCGGG - Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1029217879 7:98964772-98964794 TCAGGTGATGTGCTGGCCACCGG + Exonic
1034621478 7:152460637-152460659 AGATGTGAGCTGCTGGACACAGG - Intergenic
1035246648 7:157566708-157566730 GCACCTGAGCTGCTGTTCACTGG - Intronic
1035351208 7:158247495-158247517 GCTCGTGGGCAGCTGGGCACTGG + Intronic
1035563701 8:627740-627762 GCAGGGGAGTTGCTGGCCCCTGG + Intronic
1039531659 8:38268607-38268629 GCACGGGCGCTGCTGTTCACTGG - Intronic
1049553196 8:143270137-143270159 GCACATGAGCTGCTGACAGCAGG + Intronic
1049616440 8:143577638-143577660 CCAGGTGGGCTGCGGGCCACTGG - Exonic
1053512456 9:38700017-38700039 GCCAGTGAGCTGCAGGCCACAGG - Intergenic
1056796287 9:89660913-89660935 GCTCTTGAGGTGCTGGGCACAGG + Intergenic
1057272299 9:93658004-93658026 GCAGTTGAGCTGGTGGCCATGGG + Intronic
1057561513 9:96131482-96131504 GCAGGGGTGCTGCTGGCCTCAGG + Intergenic
1060468280 9:123927217-123927239 GCACGTGAGTTGCTAGGCACAGG - Intronic
1062133670 9:134913512-134913534 GAACGTGTGCAGCTGGCCCCAGG + Intronic
1062439187 9:136562024-136562046 GCACGGGAGCCACGGGCCACGGG - Intergenic
1185917061 X:4047342-4047364 GCCCGTGAAATGCTGGCCACTGG + Intergenic
1193312667 X:80025956-80025978 GCATCTGAGATGCTGGCGACTGG + Intronic
1197892109 X:131278460-131278482 GCACTTGAGCTGGTGGGGACAGG - Exonic
1198799431 X:140433872-140433894 GCACCAGGGCTGCTGGACACAGG - Intergenic