ID: 1152190877

View in Genome Browser
Species Human (GRCh38)
Location 17:78886526-78886548
Sequence GTGCAGAAACAGCAGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152190874_1152190877 9 Left 1152190874 17:78886494-78886516 CCGTGTGCAAAAAATAGCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 152
Right 1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG 0: 1
1: 0
2: 3
3: 46
4: 391
1152190871_1152190877 17 Left 1152190871 17:78886486-78886508 CCAGGTCTCCGTGTGCAAAAAAT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG 0: 1
1: 0
2: 3
3: 46
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152190877 Original CRISPR GTGCAGAAACAGCAGGAGCA CGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901237590 1:7675822-7675844 GTGATGGAACTGCAGGAGCAGGG + Intronic
901274971 1:7984075-7984097 ATGCTGAAACTGAAGGAGCAAGG + Intronic
901403416 1:9030329-9030351 GGACAGAAACATCAGGAACAAGG - Intergenic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901878780 1:12181824-12181846 GTGGAGAAACAGCACGAGCTGGG - Intronic
902639343 1:17756470-17756492 ATACAGAAACAGCAGACGCAAGG - Intronic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
902977311 1:20098294-20098316 GGGAAGAAACAGCAAGAGCAAGG - Intergenic
903134913 1:21302994-21303016 GGGCAGAAATAGCAGGAGCCTGG - Intronic
903214145 1:21833872-21833894 CTGCAGAACCAGCAGGCACACGG + Exonic
904047585 1:27617831-27617853 GTGCAGGAAGAGCAGTAGCCGGG - Intronic
904377585 1:30091479-30091501 GGGAAGAAAAAGCAGGAGAAGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
907951011 1:59184220-59184242 AAGCAGAAATAGCAGAAGCAAGG - Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908194172 1:61732772-61732794 GTGCAGAAACATAAGGAAAAAGG + Intergenic
908858515 1:68456069-68456091 GTGGAGAGACAAGAGGAGCAGGG - Intergenic
910248957 1:85173380-85173402 GTTCAGAATCAGCATTAGCAGGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912260823 1:108110503-108110525 GTGAAGATGGAGCAGGAGCAAGG + Intergenic
917535371 1:175870737-175870759 GTCCAGATGCAGCTGGAGCAAGG + Intergenic
917656611 1:177132512-177132534 GTGCAGATATACCAGCAGCAGGG + Intronic
920039249 1:203085221-203085243 CTGAAGAAAGATCAGGAGCAAGG - Intronic
920842434 1:209565950-209565972 GTGCACCAACCGCAGCAGCAGGG + Intergenic
921562514 1:216675584-216675606 GTGGTGAATCAGCAGTAGCATGG + Intronic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921919483 1:220650307-220650329 GTAGAGAAAGGGCAGGAGCAGGG - Intronic
922080064 1:222287308-222287330 GTGGGGAAATAGCAGGAGCTCGG - Intergenic
922240826 1:223754699-223754721 GGGCAGAGACATCAGGAGCAGGG + Intronic
923150268 1:231226914-231226936 ATGCAAAAAAAGCAAGAGCAAGG - Intronic
1063114432 10:3063972-3063994 AGGCAGAAACAGCAGGGGAAGGG + Intergenic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068510975 10:57965467-57965489 ATTCAGAAACTGTAGGAGCAGGG + Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1069906926 10:71737564-71737586 GTGCAGAGTCAGCAGGACCTGGG + Intronic
1070359907 10:75677682-75677704 TTGCAGAAACAGCAGAATTACGG + Intronic
1071044983 10:81362185-81362207 GGGCAGCAACGGGAGGAGCAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072253097 10:93597059-93597081 GTGCAGAAACAGCATACCCAAGG + Intronic
1074172972 10:110962616-110962638 GTGCAGAAATAACAGGAACTGGG - Intronic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075999337 10:126903285-126903307 GGCCAGAAACAGGAGGAGGATGG + Intergenic
1076071425 10:127493073-127493095 GTGCAGGCACAGCAGGGACATGG - Intergenic
1076512323 10:131021612-131021634 AGGCAGAAACATCAGGGGCATGG - Intergenic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1080352615 11:31402711-31402733 GTTCAGGAACAGCCTGAGCAAGG - Intronic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1081810988 11:45914024-45914046 GGGCAGCAACAGGAGGAGCAGGG + Intronic
1083454679 11:62770863-62770885 GTGCAGAAAGAGCAGAACCCTGG + Intergenic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083683875 11:64364612-64364634 ATGCAGAAAAAGCAGAACCAAGG - Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084273636 11:68041303-68041325 GGGCAGAAAGAGCTGGACCAGGG - Exonic
1084474945 11:69383542-69383564 GAGAAGAAAAAGCTGGAGCATGG + Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1085056778 11:73409216-73409238 GTGCAGAAAGAACATGAACATGG - Intronic
1085802202 11:79601043-79601065 ATGCAGAGGCAGCAGCAGCAGGG - Intergenic
1087142934 11:94783685-94783707 GTGCAGAAATAACAGTATCAAGG - Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088841901 11:113634507-113634529 GTGCAGAAAGGGAAGGAGCAGGG - Intergenic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091395206 12:150138-150160 GTGGAGAAGCAGCAGGGCCATGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092238051 12:6821989-6822011 GGGCAGAAACAGCAGGTGGCTGG - Intronic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099154437 12:79157118-79157140 GTGCAGAGGTGGCAGGAGCAGGG - Intronic
1100898641 12:99213848-99213870 TTGCAGAATAAGCAGGAGCAGGG + Intronic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1102762312 12:115398696-115398718 GTTCAGAGGCAGCAGGAGCTGGG - Intergenic
1102764676 12:115422473-115422495 GAGCAGAGAAAGCAGGGGCAAGG - Intergenic
1104276632 12:127334521-127334543 GTGCAGCTAGAGCTGGAGCAGGG - Intergenic
1105533823 13:21245290-21245312 GCCAAGAAACAGCAGGAACAAGG - Intergenic
1107247386 13:38311980-38312002 GGGCAGAGAGAGCAGGAGTAGGG - Intergenic
1107303894 13:38997145-38997167 GGGAAGAAACATCAGAAGCATGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109977026 13:69851646-69851668 GTCCAGAAAAGGAAGGAGCAAGG - Intronic
1112193273 13:97199129-97199151 GGCCAGAAACAGCAGGAGGCTGG - Intergenic
1113633031 13:111900784-111900806 GAGCAGACACAGCCGCAGCAAGG + Intergenic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113796644 13:113062005-113062027 GGGCAGTAACTGCAGGTGCAGGG + Intronic
1114181679 14:20373339-20373361 TTTCTGAAACAGCAGCAGCACGG + Exonic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116206611 14:41875312-41875334 GTGCTGGAACAGCAGGAGTTTGG - Intronic
1117458415 14:55920611-55920633 GAGCAAAACCAGCAGAAGCATGG + Intergenic
1117580104 14:57143363-57143385 GTGCTTAAACATCAGAAGCAAGG - Intergenic
1118167667 14:63353818-63353840 GTGGAGAGAGAGCAGGAGCCAGG - Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119694903 14:76705423-76705445 GTGCTGAGACAGCAGGAGCAGGG - Intergenic
1120285124 14:82490675-82490697 GTACAGAAATTGCAGGTGCAGGG + Intergenic
1120414436 14:84201438-84201460 GTGCAGACATACCAGGAGCTGGG + Intergenic
1121021093 14:90580602-90580624 GTGCAGAAGCAGCACTAGCAAGG - Intronic
1121265616 14:92600530-92600552 GTGCAGAGACACCAAGAGCCAGG - Intronic
1124951098 15:34321924-34321946 ATGCAGAAAAAGCAGGACAATGG + Intronic
1127544425 15:59976991-59977013 ATGCAGGTACAGCAAGAGCAAGG + Intergenic
1127905361 15:63372322-63372344 GTGCTGAAACAGCAGCTGAATGG - Intronic
1128360682 15:66959466-66959488 GAGCAGGGACAGGAGGAGCAAGG + Intergenic
1128868323 15:71133280-71133302 TTTCAGAAACAGCAGAAGAATGG + Intronic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1130200272 15:81819630-81819652 GAGAAGAAACAGCAGCAGCTAGG - Intergenic
1130336847 15:82963818-82963840 TTGCAGAAGCAGCAGGCCCATGG - Intronic
1130384926 15:83402775-83402797 GGATAGAAACAGCAGCAGCAAGG - Intergenic
1130822232 15:87507856-87507878 CAGCAGAAACTGCAGGTGCAAGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1133295121 16:4747890-4747912 GGGCAGGGACAGCAGGAGGACGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133640550 16:7712772-7712794 GGGAAGAAAGAGTAGGAGCAGGG + Intronic
1134908597 16:18003881-18003903 GTGCAGAAACTGCTGGAGTGCGG - Intergenic
1135748659 16:25038680-25038702 GAGCAAAGACAGCAGGTGCAGGG - Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136358328 16:29761179-29761201 GTGCAGCAGCAGCAAGGGCATGG + Intergenic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1138338188 16:56269279-56269301 GAGCAGCAACAACAGCAGCAAGG - Intronic
1138537660 16:57668373-57668395 GAGCAGGAGGAGCAGGAGCAGGG - Exonic
1139314488 16:66056716-66056738 GTGCAGAGACAGGAGGCCCATGG + Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140477154 16:75244684-75244706 GTGGAGAGCCAGGAGGAGCAAGG + Intronic
1141362466 16:83408930-83408952 ATGCAGAAACACCTGGACCAAGG - Intronic
1142418166 16:89954319-89954341 GGGCCGAGACAGCATGAGCAGGG + Exonic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143295053 17:5864799-5864821 GTGCAGATACAGGATCAGCATGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143766816 17:9143270-9143292 GTGGAGAGAAAGCAGAAGCATGG + Intronic
1143898609 17:10156549-10156571 GTGCAGGAGCTGCAGGAGAAGGG - Intronic
1144438259 17:15260567-15260589 GTCCTGAACCAGCAGGAGCACGG + Intronic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1144945427 17:18967276-18967298 GTGCAGGAACGGCAGGAGCAAGG - Intronic
1145898318 17:28473774-28473796 GGGCAGAGGCAGCAGGAGAATGG - Exonic
1146725765 17:35154647-35154669 GTCCAGAAGCTGCAGTAGCAAGG - Exonic
1147954226 17:44123419-44123441 GGACAGAGACAGCAGGAGGAGGG + Intronic
1148073714 17:44923246-44923268 GTGCAGAGGCAGCAGGCACAGGG - Intergenic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151757588 17:76083471-76083493 GTGGGGAAAAAGCAGGAGCCAGG + Exonic
1151802646 17:76386877-76386899 GTGCAGAGACAGCAGGTTCATGG - Exonic
1152167992 17:78723371-78723393 GTGCAGGGAGAGCCGGAGCAAGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152218750 17:79049390-79049412 TTGCAGGACCAGCTGGAGCAGGG + Exonic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1203161858 17_GL000205v2_random:59968-59990 GTGCTAAACCAGCAGAAGCAAGG - Intergenic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1154137183 18:11790233-11790255 GTGCAGAGACCCCAGGGGCAGGG - Intronic
1155645617 18:28073871-28073893 TTGCAGCAACCCCAGGAGCAAGG - Intronic
1156421554 18:36959594-36959616 GTCCAGGAACAGGAGGAGAAAGG - Intronic
1157430320 18:47619407-47619429 CTGCAGAAACAACAAGGGCACGG - Intergenic
1157483958 18:48073811-48073833 GTGCAGAAACTCGGGGAGCAAGG - Intronic
1157837744 18:50923161-50923183 GTTCAGAAACAAGAGGAACAGGG - Intronic
1160254447 18:77235953-77235975 GTGCAGAAAGAGCAGAAGGTGGG - Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1161002790 19:1919320-1919342 GTGCAGAAACATCAGCAGCCAGG - Intronic
1161018843 19:1998407-1998429 GCCCAGGAACAGCAGGAGCGTGG + Intronic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1163082298 19:14952884-14952906 GTGCAGAAGCAGGAGCACCAGGG + Intronic
1163395637 19:17059106-17059128 GTGGAGAGACAGCAGCAGCTGGG + Intronic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1165458162 19:35927003-35927025 GGGCAAAAAGAGCAGGATCATGG + Intergenic
1166047703 19:40239044-40239066 GTGCAGAATAAGCAGGGCCAGGG - Intronic
1166263207 19:41657435-41657457 GTGCAGAACCCACAGCAGCATGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1168383490 19:55943736-55943758 GTTGAGAAACAGCAGGACCAGGG - Intergenic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925911020 2:8573725-8573747 ATGCAAAAACACCAGGTGCAGGG - Intergenic
926173953 2:10572373-10572395 TGGCAGAAACAGCAGGACCAAGG + Intronic
927022096 2:19028099-19028121 GAGAAGAAACAACAGCAGCATGG + Intergenic
927127208 2:20022770-20022792 CTGCAGTAAGAGCAGGTGCAAGG + Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
930811224 2:55543680-55543702 CTGTACAAACAGCAGAAGCATGG + Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932107334 2:68956764-68956786 GTGAAGAAAGAGCAAGAGAAAGG - Intergenic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933438656 2:82281929-82281951 TTGCAGAAAGAGCAGGAGGTAGG + Intergenic
933980885 2:87549843-87549865 GTGCAGCCTCAGCAGGAGAATGG + Intergenic
936312945 2:111400942-111400964 GTGCAGCCTCAGCAGGAGAATGG - Intergenic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
937211854 2:120278832-120278854 GCACAGAAACAGCGGGAGCAGGG - Intronic
937225407 2:120366084-120366106 GTGGAGAAACTGCAGAAGCCTGG + Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
938112391 2:128577655-128577677 GTACAGAGACAGAAGCAGCAAGG - Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
940396461 2:153196876-153196898 GAGCAGTGGCAGCAGGAGCAGGG - Intergenic
941323661 2:164086511-164086533 GTGCAGAAGTAGCTGGACCAAGG - Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
944404729 2:199370707-199370729 TTGAAGATATAGCAGGAGCAAGG - Intronic
945395250 2:209307889-209307911 CTGCAGAGCCAGCAGGAGCTGGG - Intergenic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
947150473 2:227110182-227110204 GGGCAGAGTCAGCAGGAGCCCGG - Intronic
947534876 2:230934161-230934183 GTGGAGAAACAGCCAGTGCAGGG - Intronic
947702565 2:232246669-232246691 GTGCAGACTCAGCAGCAGCATGG - Intronic
947744560 2:232500869-232500891 GGGCAGAGACTGCAGGATCAAGG + Intergenic
948300229 2:236900558-236900580 GTGCAGGGAAAGTAGGAGCAGGG + Intergenic
1169362007 20:4958284-4958306 GTGCAGAAACTACAGGAGTAGGG - Intronic
1169734343 20:8821894-8821916 CAGCAGAAACAGGAGAAGCATGG - Intronic
1169828022 20:9790988-9791010 GAGCAGAAACAGGAGAAGGAAGG - Intronic
1172428102 20:34869783-34869805 GTGGAGGAAGAGCAGGTGCATGG + Intronic
1172553649 20:35821713-35821735 GGGCAGAAACAAGAAGAGCAAGG + Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1175065769 20:56286377-56286399 GTGCAGAAATAACAGGCTCAAGG - Intergenic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175420039 20:58825891-58825913 GTGCAGCAGCAGCAGTGGCAGGG - Intergenic
1175863178 20:62160988-62161010 GGGCACATGCAGCAGGAGCACGG + Intronic
1176416653 21:6479296-6479318 GTGCGGAAAGAGGAGGAGGAGGG - Intergenic
1178160272 21:29904409-29904431 GTGTAAAATCAGCAAGAGCAGGG + Intronic
1178240209 21:30890735-30890757 GTGCAGTGACAACAGGATCAGGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1181479605 22:23190089-23190111 GTGCAGAGGCAGCAAGACCATGG - Intronic
1182012121 22:27009875-27009897 GTGGAGAAAGAGCAGAAGCCAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1183745824 22:39691147-39691169 GGGCAGAAACAGCAGTTGCACGG + Intergenic
1184488607 22:44796241-44796263 GAGCAGAGGCAGCAGAAGCAGGG - Intronic
1185012292 22:48320985-48321007 GAGCAGAAACAGCATGATCTGGG - Intergenic
1185295794 22:50054068-50054090 GTGCACAGACTGCAGGTGCACGG - Intronic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950645586 3:14374696-14374718 TGGCAGAGACAGCAGGAGGAGGG + Intergenic
952160879 3:30691738-30691760 AAGCAGAAACAACAGCAGCAGGG + Exonic
952582993 3:34856421-34856443 GTACAGTGACAGCAGCAGCAGGG + Intergenic
953646731 3:44762164-44762186 GCGAAGAAACAGCAGAACCAAGG - Intronic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
955154320 3:56401792-56401814 GTACAGCAGCAGCAGAAGCAGGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
955878662 3:63521090-63521112 GAGCAGACACAGCAGTAGCTGGG - Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
960467332 3:118013526-118013548 GTGCACTAACAGAAGGAGAAGGG + Intergenic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961114430 3:124316558-124316580 CTGCAGAAAGAGGAGCAGCAGGG - Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
963618413 3:147572775-147572797 GTGCAGAGTCATCAGGAGCTGGG - Intergenic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
964778759 3:160311652-160311674 GTCTAGAATCAGCAGGAGTAAGG + Intronic
965057467 3:163740938-163740960 GTTCAGAAGCATCAGTAGCATGG - Intergenic
965885247 3:173437490-173437512 GTTCAAAAGCAGGAGGAGCAAGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967044898 3:185727394-185727416 GGGCAGACACAGCATGAACATGG + Intronic
967259219 3:187625625-187625647 GTGAAAAAACGGCAGGAGAAAGG - Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
968230774 3:197003408-197003430 GGGCAGCAGCAGCGGGAGCAGGG + Exonic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968624765 4:1622176-1622198 GTGCCGTTACAGCAGCAGCACGG + Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
969121395 4:4913941-4913963 GTGCAGACTGAGCAGGAGGAGGG + Intergenic
969535788 4:7755428-7755450 GGGCAGAGAGAGCAGGAGCCGGG - Intergenic
969656021 4:8499037-8499059 GGGCAGATACAGCTGCAGCAGGG + Intergenic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969703576 4:8780549-8780571 GTGCAGAAACACTTGGAGCGTGG + Intergenic
969961752 4:10951869-10951891 GTGCAGCAAGAGCAGAAGGAGGG - Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
975603571 4:76128925-76128947 GTGGAGAAAGAGTAGGAGTAGGG + Intronic
975664036 4:76716304-76716326 GAGCAGAAAGAGCAGTAGCAGGG + Intronic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
977141167 4:93374315-93374337 GTGAGGAAACAGCAATAGCAGGG + Intronic
977724518 4:100279952-100279974 GTGTAGACACTGCAGTAGCAAGG - Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978057511 4:104290722-104290744 GTACAAAAACAGCAAGAGCAAGG - Intergenic
978833384 4:113116678-113116700 CGGCAGTAACAGCAGTAGCACGG + Intronic
978862235 4:113464117-113464139 GTGCAGATACTGCAGGACAATGG - Intronic
982280491 4:153679649-153679671 GGGCAGGATCAGCAGGAACAGGG - Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982712358 4:158769506-158769528 GTGGAGAAAGAGCGGGAGGAAGG - Intronic
983914210 4:173273948-173273970 GAGCTGAAACAACAGGAGTAAGG - Intronic
984223704 4:177008474-177008496 GTGTAGATACAGCAGTAGCATGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985679949 5:1250622-1250644 GTGCAGGACCGGCAGGAGCGTGG + Intergenic
986169306 5:5303081-5303103 GGTGAGAAACAGCAGGCGCAGGG + Intronic
986178153 5:5369503-5369525 GTGGAGAAAAAGCAGAACCATGG + Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987264572 5:16239307-16239329 TTGCAGTAACAGCAGCAGCAAGG - Intergenic
987611984 5:20216868-20216890 AAGCAGAAAGAGCAAGAGCAAGG + Intronic
988230407 5:28470875-28470897 GTTAAGAAATAGAAGGAGCAAGG - Intergenic
988290510 5:29278293-29278315 ATGCAAAGTCAGCAGGAGCAGGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
992697263 5:79302441-79302463 GGCCAAAAACAGCAAGAGCAGGG + Intronic
994101319 5:95895908-95895930 GTGCAGACACTGCAGTAGCCAGG - Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996146059 5:119978213-119978235 GTGCAGAAAGAACAACAGCAGGG - Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997786696 5:136720006-136720028 GTGCAGAAATAACAGGAGGAGGG + Intergenic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
1002689235 5:181038716-181038738 CTGCATAAACAGTAGGATCAGGG - Intergenic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1004051765 6:12088516-12088538 GTCAAAGAACAGCAGGAGCAAGG + Intronic
1005250013 6:23934685-23934707 GTGAAGGCAAAGCAGGAGCAGGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1008813516 6:55534633-55534655 GAGCTGCAACAGCAGGGGCAGGG - Intronic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009361838 6:62824464-62824486 ATGCAGACACACCAGGAGTAAGG - Intergenic
1009600166 6:65788022-65788044 GCGCAGAAACCGCAGGGGCGGGG + Intergenic
1011146938 6:84227943-84227965 GTGCGGAAACACAAGGACCAGGG - Intergenic
1014042957 6:116850777-116850799 GTGCAGAAAAAGCAAGAGTTTGG + Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017201062 6:151755536-151755558 GGGCAGGAAAGGCAGGAGCAGGG - Intronic
1017544667 6:155438209-155438231 GGGCAGAATCAGCAGTAGAAAGG + Intronic
1017634557 6:156431145-156431167 GTGGAGGAACAGCAGTAGAAAGG - Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019224714 6:170500401-170500423 TTTCAGAAACAGCAGGGGCAGGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1022102240 7:27175438-27175460 ATGCACACACTGCAGGAGCAAGG - Intronic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023048513 7:36231700-36231722 TTGCAGAATCAGCAGAAGAAAGG + Intronic
1023844989 7:44115545-44115567 GGGCAGCAACAGCAGGGCCAAGG - Intronic
1024054409 7:45650753-45650775 GGGCAGAAACAGTAGAAGGAAGG - Intronic
1024251147 7:47506564-47506586 GTGGAGAGAGGGCAGGAGCAGGG - Intronic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1025795453 7:64735674-64735696 GTACAAAAACAGCAAGACCATGG + Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1027679927 7:81207263-81207285 GTGCAAAAACAGCATGTTCAAGG + Intergenic
1029905588 7:104090124-104090146 CTCCAGCAAGAGCAGGAGCAGGG - Intergenic
1030062476 7:105633932-105633954 GTGCACACACACCAGGAGGAGGG + Intronic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030775616 7:113530643-113530665 GATCAGATGCAGCAGGAGCAAGG - Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031633655 7:124075233-124075255 GTGCAGAAAGAGTAAGAGAAAGG - Intergenic
1033610715 7:142961272-142961294 GGGCAGAAGCCCCAGGAGCAGGG + Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1034893510 7:154860278-154860300 ATGGAGAGACATCAGGAGCATGG + Intronic
1035962619 8:4154520-4154542 GTGGAGAAAGAGCAGAAGCCAGG + Intronic
1036093484 8:5696201-5696223 GTCAAGAAATAGCAAGAGCAAGG + Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037538977 8:19854158-19854180 TTGCAGAAAAAGAAGGAGCTGGG + Intergenic
1038526992 8:28283291-28283313 GTGAGGAAACAGCAGAAGAATGG + Intergenic
1039119499 8:34130019-34130041 GTAAGGAACCAGCAGGAGCAAGG + Intergenic
1039174012 8:34782592-34782614 GTCCAGAATCAGGAGGAGCAGGG + Intergenic
1039725221 8:40208268-40208290 GTGCTGAAACATCGGGAGAAGGG - Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041126778 8:54649376-54649398 GTGGACAGACATCAGGAGCAAGG + Intergenic
1041153734 8:54962541-54962563 CAGCAGAAATAGCAGAAGCAAGG + Intergenic
1041996784 8:64071307-64071329 GTGCAGAATTCACAGGAGCAGGG + Intergenic
1042229473 8:66541883-66541905 GTGCGGCTACAGCTGGAGCATGG + Intergenic
1042482627 8:69321488-69321510 GTGTAGAAAAATCAGTAGCACGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1045062795 8:98423671-98423693 GTGCTGAAACACCAGGGGGAAGG + Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1046237918 8:111451047-111451069 GAGGAGAAACAGCAGGACCCTGG + Intergenic
1047163046 8:122403144-122403166 TTACAGAAACTGCAGGAGGAGGG + Intergenic
1047657848 8:126998286-126998308 GTGCAGGAATAGCCAGAGCAGGG + Intergenic
1047891945 8:129322334-129322356 CTGCAGAAACTGCAGGAACTAGG + Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1049214047 8:141399536-141399558 GCCCAGAAAGGGCAGGAGCAGGG - Intronic
1049415381 8:142492607-142492629 GTGCAGAGAAGGCAGGAGCCTGG - Intronic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1049944644 9:581846-581868 GTGCAGCAACCCCAGGAGGATGG - Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050685589 9:8164930-8164952 TTTCAGCAACAGCAGAAGCAGGG + Intergenic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1052558856 9:30057252-30057274 GAGCAAAAACAGGAAGAGCAAGG - Intergenic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053290137 9:36874323-36874345 GTGCATGAACCCCAGGAGCATGG - Intronic
1054771220 9:69086132-69086154 GTGCAGAAACTGCAAAAGGAAGG + Intronic
1055296641 9:74840049-74840071 CTGCAGAGACAACAGGAGCGTGG - Exonic
1056732330 9:89177551-89177573 GGGAAGACACAGCAGGAGTAGGG + Intronic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057437982 9:95059585-95059607 GGGCAGAAAGATGAGGAGCAGGG + Intronic
1059506729 9:114806009-114806031 CTCCAGGAGCAGCAGGAGCATGG - Exonic
1060524528 9:124313021-124313043 GTGGAGCAACCGCAGGCGCAAGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060784791 9:126442633-126442655 GTGCAAAGACACAAGGAGCAGGG - Intronic
1061119608 9:128634924-128634946 GTGGAGAAATGGCAGCAGCAGGG + Intronic
1061584368 9:131556374-131556396 GGGCAGAGACAGGAGGAGCAAGG - Intergenic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062012243 9:134273401-134273423 GTGCACAGCCAGCAGGAACAGGG - Intergenic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203770471 EBV:47582-47604 CCTCAGAAACATCAGGAGCAGGG - Intergenic
1186430199 X:9498653-9498675 CTGCAGAGACCGCAGGAGCCTGG + Intronic
1186830483 X:13385040-13385062 GAGCACACACAGCAGGAACAAGG + Intergenic
1187041916 X:15605452-15605474 GTGCTGAAACAGCAGGATGGAGG + Intergenic
1191841750 X:65518238-65518260 GCCCAGCAACAGGAGGAGCAGGG - Exonic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1192656417 X:72999587-72999609 GTCCAGAGACAGCAGGGGCTTGG - Intergenic
1192665703 X:73083414-73083436 GTCCAGAGACAGCAGGGGCTTGG + Intergenic
1194800255 X:98264225-98264247 GTGCAGCAACTGCAGCTGCAGGG - Intergenic
1195114979 X:101688224-101688246 GAGCAGGCACAGCAGCAGCAGGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200001742 X:153065649-153065671 GGGCAGAAAGAGCAGGAGCAGGG + Intergenic
1200053039 X:153444822-153444844 GTGCAGGAAGATCAGGAGCAGGG + Exonic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1201787583 Y:17802679-17802701 GTGCTAACTCAGCAGGAGCACGG + Intergenic
1201798467 Y:17927046-17927068 GTGCAGAACCATCTGGAGCCAGG - Intergenic
1201803086 Y:17978911-17978933 GTGCAGAACCATCTGGAGCCAGG + Intergenic
1201813970 Y:18103309-18103331 GTGCTAACTCAGCAGGAGCACGG - Intergenic
1201868068 Y:18676256-18676278 GTGTAGAAACAGCAGGTGTATGG - Intergenic
1202316484 Y:23584353-23584375 ATGCACACACAGGAGGAGCAAGG + Intergenic
1202359787 Y:24095736-24095758 GTGCAGAACCATCTGGAGCCAGG - Intergenic
1202510991 Y:25574378-25574400 GTGCAGAACCATCTGGAGCCAGG + Intergenic
1202554280 Y:26085705-26085727 ATGCACACACAGGAGGAGCAAGG - Intergenic