ID: 1152191809

View in Genome Browser
Species Human (GRCh38)
Location 17:78892725-78892747
Sequence TTTCTATTGTCACAAATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152191805_1152191809 8 Left 1152191805 17:78892694-78892716 CCCAGGGGACATTGGCAATGTCT 0: 5
1: 18
2: 51
3: 91
4: 328
Right 1152191809 17:78892725-78892747 TTTCTATTGTCACAAATGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 337
1152191806_1152191809 7 Left 1152191806 17:78892695-78892717 CCAGGGGACATTGGCAATGTCTG 0: 13
1: 24
2: 50
3: 90
4: 302
Right 1152191809 17:78892725-78892747 TTTCTATTGTCACAAATGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152191809 Original CRISPR TTTCTATTGTCACAAATGCA GGG Intronic
901536589 1:9886372-9886394 ATTCGATTGTCACAACTGGAGGG - Intronic
902483125 1:16722656-16722678 CTTATTTTGTCACAAATGCTGGG - Intergenic
904860598 1:33534782-33534804 TTTTTATTTGCACAACTGCATGG - Intronic
905680080 1:39864194-39864216 TTTTGATTGTCACAACTGCAGGG + Intronic
905686297 1:39911143-39911165 TTTCTATTTTCACATATAGAAGG + Intergenic
907718465 1:56949985-56950007 TTTCAACTGGCAAAAATGCAGGG + Intronic
907913176 1:58844768-58844790 TATTTTTTCTCACAAATGCAGGG - Intergenic
908832004 1:68188672-68188694 TTCCTCTTCTCACAAATGAAGGG - Intronic
910148692 1:84114469-84114491 TTTTTATTTTTACAAATGTATGG + Intronic
910534777 1:88284625-88284647 TTTTCATTGTCACAACTGAAGGG + Intergenic
911447743 1:98019622-98019644 ATTCTAATGTCAAAAATGTATGG - Intergenic
911674219 1:100640743-100640765 TTCCTATACTCACAAACGCAAGG + Intergenic
912909178 1:113739806-113739828 TTTCTGTTCTCACACATACATGG - Intronic
913389517 1:118295030-118295052 TTTCTATTGTCACAATGACAAGG - Intergenic
913612929 1:120525848-120525870 TTTATTTTGTCACAAATGCTGGG - Intergenic
914578259 1:148996400-148996422 TTTATTTTGTCACAAATGCTGGG + Intronic
915242458 1:154533045-154533067 TTTCTATTGACACCCAGGCAGGG + Intronic
916388325 1:164302380-164302402 TGTCTATTGTCAACAAGGCATGG + Intergenic
916900379 1:169215792-169215814 TTCATATTGTCACAAATGGCAGG - Intronic
917282896 1:173396173-173396195 TTTATACAGTCACAAATCCAGGG + Intergenic
917387729 1:174495223-174495245 CTTCTAGTCTCACAAATTCATGG + Intronic
918277962 1:182972679-182972701 TTTTTAATGTCAAAAAAGCATGG - Intergenic
918330178 1:183452150-183452172 TTTCTCTTTTCATAAATACAGGG + Intergenic
918333127 1:183479378-183479400 TTTTTATTGTCACGATTGCAAGG - Intronic
919041988 1:192400758-192400780 TTTCTACTGTCACTAAAGGAGGG - Intergenic
919576260 1:199313554-199313576 TTTTTGTTGTCACAACTGGAAGG - Intergenic
919953246 1:202386242-202386264 TTTCTATAGTAAAAAATACATGG + Intronic
924175032 1:241382524-241382546 TTTCTAATATCAGAAATGAAAGG + Intergenic
924790518 1:247242980-247243002 TTAGTATTTTCAAAAATGCATGG - Intergenic
1064138363 10:12769730-12769752 TTTGGATTGTCAAAAATGGAGGG + Exonic
1064909068 10:20380404-20380426 CTTCTCTCCTCACAAATGCATGG + Intergenic
1065598504 10:27343699-27343721 TTTATTTTTTCTCAAATGCAGGG + Intergenic
1067378068 10:45746200-45746222 TTGCTATTGTGAATAATGCAAGG + Intronic
1067885766 10:50086875-50086897 TTGCTATTGTGAATAATGCAAGG + Intronic
1068072150 10:52208231-52208253 TTTCTTATGTTACAAATGAAAGG + Intronic
1068183245 10:53549983-53550005 TCTATATTGTCACAAATGACAGG - Intergenic
1068459102 10:57303118-57303140 TTTCTATTATCATAAATAAATGG + Intergenic
1069090040 10:64189205-64189227 TTTTGGTTGTCACAACTGCAGGG - Intergenic
1070457350 10:76630585-76630607 TTTCTAGTGTCCCACATACAGGG + Intergenic
1072933770 10:99692321-99692343 TTTTGATTGTCACAACTGGAAGG - Intronic
1076226138 10:128777501-128777523 TTAATATTGTCACAAATGGCAGG - Intergenic
1076923970 10:133471996-133472018 TTTTTATTGTCACAACTGGAAGG - Intergenic
1076989671 11:265868-265890 TATCTACTGTCACCAATTCAAGG + Intergenic
1077880768 11:6347818-6347840 TCCATATTGTCACAAATGAAAGG - Intergenic
1078265546 11:9753787-9753809 TTTTTGTTGTCACAACTGGAGGG + Intergenic
1079769050 11:24435434-24435456 TTTCGAATGTCACAAGTGAAAGG + Intergenic
1080210341 11:29778737-29778759 TTTCCCGTGTCAAAAATGCAGGG + Intergenic
1081145338 11:39556519-39556541 TTCCTGTTGTCACAAATGAGAGG - Intergenic
1081445505 11:43127830-43127852 TTTCATTTATCACAAATTCATGG - Intergenic
1081632448 11:44699128-44699150 TTTCGATTGTCACAAAGATAAGG - Intergenic
1084101274 11:66951276-66951298 TTATTGTTGTCACAAATGCTGGG + Intronic
1087828894 11:102797491-102797513 TTTCTTTTGTCAGAAATACCTGG - Exonic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1091958455 12:4669204-4669226 TTTCAGTTGTCACAACTGAAGGG - Intronic
1092930339 12:13309539-13309561 GTTCTATTCTGATAAATGCATGG + Intergenic
1094002562 12:25711166-25711188 TTGCCATTGTTCCAAATGCATGG - Intergenic
1095533057 12:43213104-43213126 TTTCTAGAATCACAAATGCTTGG + Intergenic
1095775470 12:46004821-46004843 TTTTTATTTTTACAAAGGCAAGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097335258 12:58375718-58375740 TATTTATTGTCACAAATGATAGG + Intergenic
1098475617 12:70898868-70898890 TTTCTAATATCAGAAATGAAAGG + Intronic
1098525533 12:71482627-71482649 TATTTATTGTCACAACTGGAAGG + Intronic
1098704480 12:73670878-73670900 TTTCTATTTTCAGAACTGTAAGG + Intergenic
1098873053 12:75837840-75837862 TTTCTGTTGCAACAAATGCCTGG - Intergenic
1098957969 12:76707093-76707115 TTATTCTTGTCACAAAAGCAGGG - Intergenic
1099131821 12:78842389-78842411 TTTCTTTTTTTACAAATGGAAGG + Intergenic
1100189602 12:92176669-92176691 TTCCTGTTGTCACAACTGCCAGG - Intergenic
1100508293 12:95242699-95242721 TTTGTATTTTTACAAATACAGGG - Intronic
1100607899 12:96166738-96166760 TTTCTGTTGTAACATATCCAGGG - Intergenic
1101034146 12:100688363-100688385 GTGCTGTTGTCACAAATCCACGG + Intergenic
1101099250 12:101375383-101375405 TTTTGATTGTCACAACTGGAGGG + Intronic
1101167980 12:102058885-102058907 TTTATGTTGTCACAAATGACAGG - Intronic
1101177902 12:102175470-102175492 TTTCTATTTTCAGCATTGCAGGG + Exonic
1101664437 12:106798171-106798193 TTTTTGTTGTCAAAAATGTAAGG + Intronic
1102411052 12:112719056-112719078 TTTTTGTTGTCACAAATGGAGGG + Intronic
1103790739 12:123469071-123469093 TTTTGATTGTCACAACTGGAGGG - Intronic
1104670884 12:130679326-130679348 GTTCTCTAGACACAAATGCATGG - Intronic
1105613554 13:21991239-21991261 TCTATATTGTCACAAATGGCAGG + Intergenic
1105726566 13:23168283-23168305 TTTCTATAGTGACAAATTAAGGG - Intergenic
1106413027 13:29524238-29524260 TTTCTAGTGACACAAAAGAAGGG - Exonic
1108560524 13:51639062-51639084 TTTTTATTGTCACAAAATCAAGG + Intronic
1108813885 13:54267278-54267300 TTCCTCTTGTCTCAACTGCAAGG + Intergenic
1109332431 13:60946019-60946041 TATGTATTCTCACATATGCACGG - Intergenic
1109432478 13:62253209-62253231 TTGCTATTGTAAATAATGCAGGG + Intergenic
1110218076 13:73045258-73045280 TTTATCATGTCCCAAATGCATGG - Intergenic
1110538356 13:76678873-76678895 TTCATATTGTCACAAATGGCAGG - Intergenic
1110880979 13:80571983-80572005 TTTTTATTTTGACATATGCAAGG - Intergenic
1111069371 13:83144030-83144052 TTTCTATTGTCACCAGTGACAGG - Intergenic
1111077718 13:83260467-83260489 TTTATGTTGTCACAAATGACAGG - Intergenic
1112209198 13:97357938-97357960 TTTCAATTGTCACACATAAAAGG - Intronic
1112502098 13:99950746-99950768 TTTCTACTGCCACAAATGTAAGG + Intergenic
1112830047 13:103438508-103438530 CTTTTGTTGTCACACATGCAGGG + Intergenic
1113001648 13:105645656-105645678 TTTTTACTGTCATAATTGCATGG + Intergenic
1114324266 14:21573175-21573197 TTCATATTGTCACAAATGACAGG - Intergenic
1114813287 14:25926636-25926658 TTTGAAGTGTCACAAAAGCATGG - Intergenic
1115305955 14:31933627-31933649 TTTATGTTGTCACAAATGGCCGG + Intergenic
1116178777 14:41509228-41509250 TTTCTTTTGTAATAAATGAATGG - Intergenic
1116895805 14:50313606-50313628 TCTCTATTCTTACAATTGCATGG - Intronic
1118101078 14:62603491-62603513 TTTCAATAGTGACAAATACATGG - Intergenic
1118113324 14:62747486-62747508 TTTCTATAGCCACAAAGGCATGG + Intronic
1118475706 14:66115019-66115041 TTTTGGTTGTCACAACTGCAGGG - Intergenic
1118659576 14:67993498-67993520 TTTATGTTGTCACAAATGACAGG + Intronic
1118695634 14:68382267-68382289 TTTTGGTTGTCACAAATGAAGGG - Intronic
1119464157 14:74841028-74841050 TTTGTAGGATCACAAATGCAAGG - Intronic
1121790010 14:96692044-96692066 TTCATATTGTCACAAATGGCAGG - Intergenic
1122572520 14:102715958-102715980 TTTCTGTTGTCACAACTGGTAGG - Intronic
1122715823 14:103696493-103696515 TTTCCATTGTCATAACTGTATGG + Intergenic
1124094116 15:26632897-26632919 TTTCTCTTGTCTCAAGAGCAGGG + Intronic
1126600311 15:50421723-50421745 TGACTATGGTCACAAATGGATGG + Intergenic
1129875968 15:78975973-78975995 TGGCTACTGTCACACATGCAGGG - Intronic
1129914107 15:79253427-79253449 TTACTATTGTCATAAGTGCCAGG + Intergenic
1130766421 15:86876023-86876045 TTTCATTTGTCATAAATGCTGGG + Intronic
1130973760 15:88756914-88756936 TTGCTACAGTCTCAAATGCATGG + Intergenic
1131973366 15:97915235-97915257 TTTGGATTTTCACAATTGCAGGG + Intergenic
1132082785 15:98881625-98881647 TTTCTATTGTCTAAAAGGAAGGG - Intronic
1132799654 16:1745674-1745696 TTTTTGTGGTCACAAATGAAGGG - Intronic
1134632742 16:15768650-15768672 TTTCTATTAAAACAAATGTAAGG - Intronic
1135416475 16:22272073-22272095 TTTCTATTGTAAGAAAGGCGTGG - Intronic
1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG + Intergenic
1137469183 16:48739462-48739484 TTTTTATTTGTACAAATGCATGG + Intergenic
1139180452 16:64741716-64741738 TTACTAATGACACATATGCATGG + Intergenic
1142690475 17:1603409-1603431 TTTCATTTGACACAAATGCTAGG + Intronic
1143482484 17:7235682-7235704 CTTTTATTGCCAGAAATGCAAGG - Exonic
1144163135 17:12581407-12581429 TTCCCATTGTAGCAAATGCATGG - Intergenic
1146769305 17:35553947-35553969 TTTTTATTGTCACAATTGGAGGG + Intronic
1146969288 17:37059399-37059421 TGCCTGTTGTCACAAATACACGG + Intergenic
1148379633 17:47185928-47185950 TTTTGGTTGTCACAAATGGAGGG + Intronic
1149225814 17:54469091-54469113 TTTCAAATGTCAGAAATGAAAGG - Intergenic
1150060858 17:62066767-62066789 TTTGTATAGTTACAAATGAATGG + Intergenic
1150554453 17:66241473-66241495 TTTGTATTTTTACAAAAGCAGGG + Intronic
1151007028 17:70449461-70449483 TTTATTTTAACACAAATGCATGG + Intergenic
1152191809 17:78892725-78892747 TTTCTATTGTCACAAATGCAGGG + Intronic
1152476962 17:80524764-80524786 TTTCAATTGTCACAATTGGGAGG + Intergenic
1154240876 18:12653127-12653149 TTTTTAATGTCACAATTGCAGGG + Intronic
1155821230 18:30380455-30380477 TTTCTGTTTTCACAAATATATGG - Intergenic
1158572934 18:58612086-58612108 TTTTGATTGTCACACATGGAGGG - Intronic
1158983065 18:62784202-62784224 TTTTCATTGTCACAAATAGAGGG + Intronic
1162434864 19:10652072-10652094 TTTCTTTTGACACAGCTGCAAGG - Intergenic
1163321588 19:16577838-16577860 TTTATATTGTCACAAAGGACCGG - Intronic
927010387 2:18897911-18897933 TTTATGTTGTCACATATGGAGGG + Intergenic
928663928 2:33531522-33531544 TTTAGAAGGTCACAAATGCAGGG - Intronic
929073896 2:38061421-38061443 TTTTTATGGTCACAAAATCAGGG - Intronic
929278488 2:40051549-40051571 TTTCTTTTGTCATAACTGAATGG + Intergenic
931241260 2:60454284-60454306 TTTCTATTGGGAAATATGCAGGG + Intronic
932011386 2:67981290-67981312 CTTCTATTGTCACTACTGAATGG + Intergenic
932482974 2:72060141-72060163 TTTCTATTGTCTCAAATTTTCGG + Intergenic
933112522 2:78421637-78421659 TTTCCTTTGGCAAAAATGCATGG + Intergenic
933915680 2:86990760-86990782 TTTCAATTGCTGCAAATGCATGG + Intronic
934007313 2:87779142-87779164 TTTCAATTGCTGCAAATGCATGG - Intronic
934127796 2:88915446-88915468 TTACAAGTGTCACCAATGCATGG - Intergenic
935544836 2:104389768-104389790 TTTATGTTGTCACAAATGACAGG - Intergenic
935839539 2:107094210-107094232 TTTCTATTGACAGAAATAAATGG + Intergenic
935909125 2:107875882-107875904 TTTCAATTGCTGCAAATGCATGG + Intronic
935995800 2:108771315-108771337 TTTCAATTGCTGCAAATGCATGG + Intronic
936472625 2:112812475-112812497 TATCTATTGTGACAAATGGCTGG - Intergenic
937391425 2:121490786-121490808 TTTCCATAGTCACGAATACAAGG - Intronic
937896940 2:126983912-126983934 TCTCTAATGTCACAGATCCATGG - Intergenic
939008782 2:136820437-136820459 GTTATTTTGCCACAAATGCAAGG + Intronic
939343630 2:140933334-140933356 TCTTTATTATCACAAAAGCAGGG + Intronic
939490714 2:142873226-142873248 TTTCTAGTGTCACTAATAAACGG - Intergenic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
940486050 2:154296509-154296531 TCTTTATTGTGAAAAATGCAAGG - Intronic
940850749 2:158686053-158686075 TTTTTAATGTTACAAATGCAGGG + Intergenic
942238706 2:173938938-173938960 TTTTTATTATCACAACTGCCTGG + Intronic
944076013 2:195731565-195731587 TTTCTAGTGTTACAGATGTAAGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944493241 2:200279546-200279568 TTTCTAAATTCAGAAATGCAGGG - Intergenic
944506523 2:200418113-200418135 TTTCAATTGTATAAAATGCAGGG + Intronic
944660182 2:201915300-201915322 GTTTTACTGTCACAAATTCAGGG + Intergenic
946615642 2:221506546-221506568 TTTCTCTTTTCAAACATGCAGGG + Intronic
947420197 2:229935213-229935235 TTTGTATAGGCACAAATCCAGGG - Intronic
1169410519 20:5365713-5365735 TTTCTTTTGTTACAAATAAAGGG - Intergenic
1170856811 20:20064262-20064284 TTTCCATTTTCACAATTTCACGG + Intronic
1172297651 20:33824785-33824807 TTTTTGTTGTCACAACTGGATGG - Intronic
1172415730 20:34765646-34765668 TTTTAAGTGGCACAAATGCAGGG + Intronic
1173831799 20:46094094-46094116 CTTCCATTTTGACAAATGCAGGG + Intergenic
1174498725 20:50968501-50968523 TTTTGATTGTCACAACTGCGGGG + Intergenic
1174995247 20:55559692-55559714 TTTCTATTGTCAAATATTAAAGG - Intergenic
1176726656 21:10441074-10441096 TGTCTCTTGTCAAAAAAGCAGGG - Intergenic
1177650358 21:23952525-23952547 TTTCCATTTTTACATATGCAGGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178313563 21:31550810-31550832 TTTCTAATTTCACAAGGGCAGGG + Intronic
1178530509 21:33372052-33372074 TTTCGGTTGTCACAACTGGAGGG + Intergenic
1178806766 21:35845874-35845896 TTTTCAGTGTCTCAAATGCAAGG + Intronic
1178888559 21:36501267-36501289 TTTATATTGCCACATCTGCAGGG + Intronic
1180287732 22:10766010-10766032 TGTCTCTTGTCAAAAAAGCAGGG + Intergenic
1182346820 22:29672260-29672282 TTTGGATTGTTACAAATGGAGGG - Intronic
1182919404 22:34065538-34065560 TTTTCATTGTCACAATTCCAGGG + Intergenic
1183128260 22:35806209-35806231 TTTCTGTTCCCACACATGCATGG - Intronic
1183560270 22:38567391-38567413 TTTTGATTGTCACAGCTGCAGGG + Intronic
1184631686 22:45786262-45786284 TTTATTTTGTCACAAAAGCTTGG + Intronic
949242029 3:1885019-1885041 TTTCTAAAGTCTCAAAAGCAAGG + Intergenic
949633321 3:5953686-5953708 TTCCTGTTGTCACAAATGGCAGG + Intergenic
949839842 3:8307761-8307783 TTGTTATTGTCACAACTGGAAGG - Intergenic
949839852 3:8307833-8307855 TTGTTATTGTCACAACTGGAAGG - Intergenic
951289453 3:20856994-20857016 TTTCTATGGTAACAAATGACGGG + Intergenic
951336619 3:21430640-21430662 TTTCTATAGTCACACTTTCAGGG - Intronic
951609532 3:24476824-24476846 TTAAAATTGTCTCAAATGCAAGG - Intronic
951631771 3:24729498-24729520 TTTTGATTGTCACAAATGGCAGG + Intergenic
952747734 3:36797047-36797069 GTTCTATGGTCATAAAGGCAAGG - Intergenic
955057168 3:55465139-55465161 TTTTGATTGTCACAAATGGAAGG + Intergenic
955445155 3:59001749-59001771 TTTCTAATCTCGCAAAAGCAGGG + Intronic
955671753 3:61409780-61409802 TTTTTATTGTCACAAATAGGGGG - Intergenic
956324787 3:68039986-68040008 TTTCTATGAACATAAATGCAGGG - Intronic
956330955 3:68107581-68107603 TTTCAATTGTCACAATTGTTTGG + Intronic
956967938 3:74485501-74485523 TTTCTATTTTAACAATGGCAAGG - Intronic
957687824 3:83525829-83525851 TTTTTATTGTCACAAGTGTGTGG - Intergenic
958812755 3:98880742-98880764 TTTCTCTTGTAAAAAATACAGGG - Intronic
960729018 3:120703471-120703493 CTTGTATTGGCAAAAATGCAAGG + Intronic
961123750 3:124397261-124397283 TTTCTACTCCCACAACTGCACGG - Intronic
962150495 3:132888050-132888072 TTTATATTTTTAAAAATGCACGG + Intergenic
962662821 3:137621490-137621512 TATATGTTGTCACACATGCAAGG - Intergenic
962980810 3:140487814-140487836 TTTCATTAGTCACAAATACAGGG + Intronic
963198407 3:142560109-142560131 TTTCTATTGAGTCAAATGCTAGG - Intronic
964021164 3:152012804-152012826 TTCCTATTGCCACAAAGGGAAGG - Intergenic
967142645 3:186574376-186574398 TTTTTATAGTCTCAAATGCAGGG + Intronic
967402422 3:189078620-189078642 TTTCTCTTGTCATGAATTCAGGG + Intronic
967753137 3:193137790-193137812 TTTCTATTGTGAGAGATGCTAGG + Intergenic
968204583 3:196787915-196787937 TTTCTATGTTTACAAAAGCACGG - Intronic
969314059 4:6370983-6371005 CTTCTCTTGTCCCAAAGGCATGG - Intronic
970392130 4:15623701-15623723 TTTCTGTTTTCTCAAATCCAAGG - Intronic
971545160 4:27876691-27876713 TTTCTAATGTTTCAAATGGAAGG + Intergenic
971816771 4:31501039-31501061 TTTCTATAGTCCCATAAGCAGGG - Intergenic
972381729 4:38525848-38525870 TTTCTATTTTCATAAAAGCAGGG + Intergenic
972547841 4:40097961-40097983 TTTTTATTGTCACAACTGGGTGG - Intronic
974202071 4:58655423-58655445 TTTTCATAGTCACCAATGCATGG - Intergenic
974380763 4:61137049-61137071 TGTCTTTTGTTCCAAATGCATGG - Intergenic
975668482 4:76756460-76756482 TTTCTAAAGTGACAATTGCAAGG + Exonic
976045619 4:80943430-80943452 TTTCTATTTTCAAAAAAGAAAGG + Intronic
976531465 4:86158197-86158219 TTTTTTTTATCACAACTGCAAGG + Intronic
976536589 4:86224286-86224308 TTTCAACTGTGACAAATGCCGGG + Intronic
977497310 4:97793974-97793996 TTTTTATTTTAAAAAATGCATGG + Intronic
977618731 4:99112792-99112814 TTTCTCTTTTCATAGATGCAAGG + Intergenic
978946350 4:114502795-114502817 TTCCTTTTGTCACAAATGACAGG + Intergenic
980431989 4:132713258-132713280 TTTCTACTAACACATATGCAAGG + Intergenic
980673234 4:136038052-136038074 TTTCTATTCTCAGAATGGCAAGG - Intergenic
980967979 4:139542074-139542096 TTCATATTGTCACAAATGACAGG - Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981884502 4:149657321-149657343 TTCATATTGTCACAAATGACGGG + Intergenic
981893438 4:149766567-149766589 TTTGTATTGTCCCAAAGGCTGGG + Intergenic
983175470 4:164583339-164583361 TTTCTATTTTCTTAAATGTATGG + Intergenic
983675239 4:170284666-170284688 GTTATATTATCACAATTGCAAGG - Intergenic
984468435 4:180131415-180131437 TTTCTTTTGTCACTAGTTCAAGG - Intergenic
984576919 4:181461587-181461609 TTTCTATTGCTACAATTTCAAGG + Intergenic
984714217 4:182911621-182911643 TCTATAATGTCACACATGCAGGG - Intronic
984783600 4:183548255-183548277 TTCATATTGTCACAAATGACAGG + Intergenic
986973394 5:13364696-13364718 TTTCTAATATCAGAAATGAAAGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988576409 5:32429575-32429597 TATCTATTATCTGAAATGCATGG + Intronic
990446794 5:55900579-55900601 TTTCCATAGTGACAAATGGAAGG - Intronic
992114104 5:73523037-73523059 TCTCTATTGTCACATGTGAATGG - Intergenic
992133962 5:73723743-73723765 TTTCTAATATCACAAAGGCGTGG + Intronic
992392745 5:76344267-76344289 TTTCTTTTGTAACAAATCAAGGG - Intronic
993037942 5:82777883-82777905 TTTCTAATCTCAGAAATGCTTGG + Intergenic
993089171 5:83402471-83402493 TTTCTATTATCATGAAAGCAAGG - Intergenic
994056163 5:95418453-95418475 TTTCCTTTGTCACAATTTCATGG - Intronic
994279394 5:97883969-97883991 TTTCTAATTTCCCAAATGCACGG + Intergenic
994581858 5:101652850-101652872 TTTCTATTGTCACATTTTTAAGG + Intergenic
994668857 5:102742311-102742333 TTATTTTTTTCACAAATGCAGGG + Intergenic
994888265 5:105594949-105594971 TTTGTATTTTCACCAATGTATGG + Intergenic
994961952 5:106616563-106616585 ATTCTGTTTTCACAATTGCATGG - Intergenic
994983547 5:106905982-106906004 TTTATAGTGTCAAAAATGTAGGG + Intergenic
995005848 5:107194556-107194578 TTTATATTGTCAGAGATGCCTGG - Intergenic
995880095 5:116835268-116835290 TTTCTTTTGTCACTATTTCAAGG + Intergenic
997906687 5:137823971-137823993 TTCATATTGTCACAAATGGCAGG - Intergenic
999293974 5:150446464-150446486 TTTCATTTGTGACAAATGCCAGG - Intronic
999339891 5:150761367-150761389 TTTTTATTTTCACCAAGGCAGGG - Intergenic
999509253 5:152230835-152230857 TTTGTACTCTCACAAAGGCAGGG - Intergenic
1000099840 5:158005043-158005065 TTTGTGTTGTCACAAATGACAGG + Intergenic
1002006821 5:176240858-176240880 TTTTTAATGAGACAAATGCAAGG + Intronic
1002008628 5:176257903-176257925 TTTTTATTGTCACAAGTTGAGGG - Intronic
1003323802 6:5076676-5076698 TTTCAGTTGTCACAATTCCAAGG + Intergenic
1003501617 6:6707932-6707954 TTTTGATTGTCACAAGTGGAGGG - Intergenic
1004525040 6:16399683-16399705 TTTTGATTGTCACAACTGCCGGG + Intronic
1006971640 6:38051238-38051260 TTTCTCCTGTCACATCTGCATGG + Intronic
1007757879 6:44112230-44112252 TTCCTATTGTCACGACTGCATGG - Intergenic
1007795201 6:44341552-44341574 CCTCCATAGTCACAAATGCATGG - Intronic
1008471133 6:51886481-51886503 TCTGTATTGTCACAAATGGCAGG - Intronic
1008684445 6:53909441-53909463 TATGTATAATCACAAATGCAAGG + Intronic
1008710649 6:54222522-54222544 TTTATATTGTCACAGATGGCAGG + Intronic
1009494343 6:64329696-64329718 TTTCTATTATCCCAAATTTAAGG - Intronic
1010354266 6:74912016-74912038 TAGCTATTATGACAAATGCAGGG - Intergenic
1011431031 6:87287055-87287077 TTTTTGTTGTCACAAATGGTAGG - Intronic
1011686443 6:89827877-89827899 TTTTTATTTGCACATATGCATGG - Intergenic
1011697624 6:89926745-89926767 TTTTTATTGTAAAAAATGAAAGG - Exonic
1013129117 6:107214635-107214657 TTTCTCTTTTCACAATTGCTTGG + Intronic
1013911967 6:115286515-115286537 TTCTTATTGTCACAAATGCCAGG + Intergenic
1014399457 6:120969487-120969509 AATCAATTGTCATAAATGCATGG - Intergenic
1014950750 6:127552058-127552080 TTTCTACTGTCACAACTGGAAGG - Intronic
1015240692 6:131020308-131020330 TTTCTATTGTCTTAAATATAAGG + Intronic
1016375112 6:143412338-143412360 TTCCTATTGACACAATTCCAAGG + Intergenic
1017288566 6:152707792-152707814 TACCAATTGTCACAAATGCATGG + Intronic
1017319309 6:153070257-153070279 TCTCTATTCTCACATATCCATGG + Intronic
1019139069 6:169932095-169932117 TTTTTATTGTCACAACTGGGAGG - Intergenic
1020522344 7:9207341-9207363 TTTCTTTTATCAAAATTGCAGGG - Intergenic
1020940380 7:14526339-14526361 TTTTTATTGTCACAACTTGAGGG - Intronic
1021072792 7:16263320-16263342 TCTCTATTGTCACAAATACTGGG + Intronic
1021202664 7:17742808-17742830 TCTCTGTTGTTACAAATGGAGGG - Intergenic
1021410207 7:20321541-20321563 TTTCTATTGCCACTTCTGCAAGG - Intergenic
1022001905 7:26233958-26233980 TTTTCATTGTCACAACTGGAGGG - Intergenic
1022120762 7:27305911-27305933 TTTCTATGGTCGCAAAATCAAGG + Intergenic
1022503363 7:30896193-30896215 TCTCTATTATCGCAAATGCCTGG - Intergenic
1023275014 7:38509616-38509638 TTTCAAGGGTCACAAATTCAAGG - Intronic
1023696146 7:42849491-42849513 TTTATATCGTCACAAATGGCAGG - Intergenic
1025006184 7:55356806-55356828 TTTTTATTGTCACAACTGTTGGG + Intergenic
1026234539 7:68514763-68514785 TTCATATTGTCACAAATGGCAGG + Intergenic
1026514295 7:71054550-71054572 TCTGTATTGTCACAAATGACAGG - Intergenic
1027728038 7:81831969-81831991 TTTCTATTGACACATATTCAAGG - Intergenic
1027946593 7:84753964-84753986 TTTGTATTGTCACATATGACAGG - Intergenic
1028348112 7:89808613-89808635 TTTTTTTTGTGACAAATGAAAGG - Intergenic
1028618985 7:92802889-92802911 TTTTGGTTGTCACAAATGGAGGG - Intronic
1030582403 7:111374580-111374602 TTTATACTGTGAAAAATGCAAGG - Intronic
1031303529 7:120094876-120094898 TTTCCATTTTCACCACTGCATGG + Intergenic
1031375482 7:121019784-121019806 TATATGTTCTCACAAATGCAGGG - Intronic
1031652686 7:124310410-124310432 GATTTATTGTCACAAAAGCAAGG + Intergenic
1034603452 7:152286881-152286903 TGTCTTTTGTCAAAAAAGCAGGG + Intronic
1036028576 8:4939483-4939505 TTCATATTGTCACAAATGACAGG - Intronic
1036090563 8:5660792-5660814 CTTCCATTGGCACAAATACAGGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037168468 8:15860046-15860068 TTTCTATTCTCTCAAATTTAAGG + Intergenic
1038254916 8:25942251-25942273 TTTTTATTGGTACAAATGTATGG + Intronic
1038765560 8:30424474-30424496 TTTCCAATGTCACAAAAGCTGGG - Intronic
1038986084 8:32811702-32811724 TTTCTGTTATTATAAATGCAGGG + Intergenic
1040833644 8:51707827-51707849 TTTATGTTGTCACAAATGGTAGG + Intronic
1042380591 8:68108882-68108904 TTTATGTTGTCACAAATGACAGG - Intronic
1042442462 8:68844209-68844231 TTTTTAATGACACAAATGTAGGG - Intergenic
1043332568 8:79135601-79135623 TTTCTTTTGTACTAAATGCATGG + Intergenic
1043987032 8:86705804-86705826 TTTGTATTTGCACCAATGCATGG + Intronic
1044826702 8:96205358-96205380 TTTATGTTGTCACAAATGACAGG + Intergenic
1045674765 8:104594827-104594849 TTGCTATTTTCAAAAATTCAAGG - Intronic
1045718915 8:105082604-105082626 TTTCCATTTTCACAGCTGCATGG + Intronic
1048358940 8:133678507-133678529 TTTTTATTATCATAAAAGCATGG - Intergenic
1048816512 8:138339530-138339552 TTTCTGATGTCACGAAAGCATGG - Intronic
1050028052 9:1356371-1356393 TTTTGGTTGTCACAACTGCAGGG + Intergenic
1051819840 9:21151559-21151581 TTTCTATAGTAACAAACTCAGGG - Intergenic
1051897127 9:21998501-21998523 TTTCTGTTGTCCCAAAGGCCAGG + Intronic
1055716022 9:79119007-79119029 TTTTTATTTTCATAAAGGCAAGG + Intergenic
1055969473 9:81897426-81897448 TTTCTGTTGTCTAGAATGCAGGG + Intergenic
1057748922 9:97774248-97774270 TTTCTAATACCACAAATTCAAGG + Intergenic
1059763435 9:117361178-117361200 TTTGTCTTTTCACAAATGCTCGG - Intronic
1186085417 X:5984276-5984298 TTTCTACTGTATCTAATGCATGG - Intronic
1186999345 X:15159128-15159150 TTTCGGTTGTCACAACTGGAAGG + Intergenic
1187045508 X:15644647-15644669 TTTTTATTGTCACAGCTGGAGGG - Intronic
1188160055 X:26788726-26788748 TTTATATTGTCACAAATGGCAGG + Intergenic
1188503804 X:30859198-30859220 TTTCAGTTGTCACAACTGCGGGG + Intronic
1188716611 X:33466023-33466045 TTTTTATTGTTATAAATGCTTGG - Intergenic
1188839193 X:34994236-34994258 ATTTTATTGTCACAAATGTTAGG + Intergenic
1188990161 X:36809083-36809105 TTCATATTGTCACAAATGGCAGG + Intergenic
1189749063 X:44200350-44200372 GTTCTATTGTCCCAAATTCATGG - Intronic
1190175293 X:48143855-48143877 TTTCTAGTGTCACAAATTCATGG - Intergenic
1190187885 X:48251852-48251874 TTTCTAGTGTCACAAATTCACGG + Intronic
1191029905 X:55958577-55958599 TTTTTACTGTTATAAATGCATGG + Intergenic
1191689046 X:63921248-63921270 TGTCTTTTGCCACAAATGGAAGG - Intergenic
1192625410 X:72722051-72722073 TTTTCATTGTCACAAATGGCAGG - Intergenic
1193511183 X:82401632-82401654 TGTCTATTACTACAAATGCAAGG - Intergenic
1193892253 X:87064245-87064267 TTTGTGTTGTCACAAATGGCAGG - Intergenic
1196567333 X:117224245-117224267 TTCATATTGTCACAAATGATAGG + Intergenic
1197815613 X:130494951-130494973 TTTTGATTGTCACAAATGATGGG + Intergenic
1197858238 X:130941683-130941705 TTTGTGTTGTCACAAATGGCAGG + Intergenic
1197879319 X:131148556-131148578 TTTATATTGGCACAAACTCAAGG + Intergenic
1199062930 X:143380162-143380184 TTTCTATTCTCAGAAAGCCATGG - Intergenic
1199242841 X:145568570-145568592 TGTCTATTGCCACAAATGACAGG + Intergenic
1201224158 Y:11800739-11800761 TTTATGTTGTCACAAATGATAGG - Intergenic
1202581415 Y:26385016-26385038 TTTCTATAGTAAAAAATACATGG - Intergenic