ID: 1152191879

View in Genome Browser
Species Human (GRCh38)
Location 17:78893071-78893093
Sequence GTGTGTGCACGCGTGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 5, 2: 14, 3: 135, 4: 582}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152191876_1152191879 -1 Left 1152191876 17:78893049-78893071 CCAAGCATGTGTGTGTGCAGGAG 0: 1
1: 0
2: 0
3: 44
4: 331
Right 1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG 0: 1
1: 5
2: 14
3: 135
4: 582
1152191874_1152191879 3 Left 1152191874 17:78893045-78893067 CCTGCCAAGCATGTGTGTGTGCA 0: 1
1: 0
2: 2
3: 30
4: 250
Right 1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG 0: 1
1: 5
2: 14
3: 135
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152191879 Original CRISPR GTGTGTGCACGCGTGTGCAG GGG Intronic
900101921 1:965642-965664 GTGGGTGCACACGCGTGCACTGG + Exonic
900137372 1:1123535-1123557 GTGTGTGCAGGAGTGTGCGCAGG - Intergenic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137421 1:1124052-1124074 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137425 1:1124102-1124124 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215478 1:1479381-1479403 GTGTGTGCCCATGTGTGCAGGGG - Intronic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222916 1:1518829-1518851 GACTGTGCCCGAGTGTGCAGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358736 1:2277689-2277711 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358745 1:2277760-2277782 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358952 1:2278806-2278828 CTGTGTGCACGTGTGCGCATGGG - Intronic
900384115 1:2401519-2401541 GTGTCTGCACGGGTAGGCAGAGG + Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900480622 1:2896898-2896920 ATGTGTGCATGGGTGTGCATGGG - Intergenic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
900544629 1:3221704-3221726 GTGTGTGCATGCGTGTACATGGG - Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
900850243 1:5137002-5137024 GTGAGTGCAAGAGTGTGCATGGG - Intergenic
900953658 1:5873791-5873813 AGGTGTGCACTTGTGTGCAGGGG - Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902489584 1:16771477-16771499 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
902538310 1:17134643-17134665 GTGTGTGGGCGTGTGTGCACAGG - Intergenic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
904172415 1:28600576-28600598 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
904697529 1:32338599-32338621 GTGTGTGTGCGCGTGTGCCCAGG + Intergenic
905110348 1:35590238-35590260 ATGTGTGCATGCATGTGCAATGG + Intronic
905296136 1:36955537-36955559 GTGTGTGCATGCGTGTTCTCCGG - Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
907298618 1:53471256-53471278 GTGTGGACAAGGGTGTGCAGAGG + Intergenic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
908481495 1:64544583-64544605 GTTTGTGCGCACGTGTGCATGGG - Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
910063445 1:83122096-83122118 GTGCGCGCATGCGTGTGCAGTGG + Intergenic
910105164 1:83624309-83624331 GTGTGTGTGCGCGTGCCCAGAGG + Intergenic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
913591779 1:120336007-120336029 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
913651577 1:120919139-120919161 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914169532 1:145209931-145209953 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
914524644 1:148453893-148453915 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914599026 1:149181940-149181962 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914641756 1:149613242-149613264 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
915586976 1:156849203-156849225 GTGTGTGGCCGCGTGTCCACCGG + Intronic
916352810 1:163871066-163871088 GTGTGTGAATGTGTGTGCATAGG + Intergenic
916693329 1:167212146-167212168 GTGTGTGTACCTGTGTGTAGAGG + Intergenic
919685418 1:200479533-200479555 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
919770031 1:201152211-201152233 GTGTGTGCACCTCTGTCCAGTGG + Intronic
920047608 1:203143551-203143573 GTGTGTGTTTGTGTGTGCAGGGG + Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920710201 1:208287602-208287624 GTGTGTGCACATGTCTGCACAGG - Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
921874703 1:220181393-220181415 GTGTATGCATGCATGTGTAGGGG + Intronic
921922724 1:220686929-220686951 GGGTGTGTACCTGTGTGCAGTGG - Intergenic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922719081 1:227891232-227891254 GTGTGCTCACACGTGTGCACGGG - Intergenic
922765839 1:228156371-228156393 GTGTATGCATGTGTGTGCATGGG + Intronic
922852405 1:228744746-228744768 CTGTGTGCATGAGTGTGCATGGG - Exonic
922881886 1:228987228-228987250 GTGTGTGTATGCGTGTGGGGGGG - Intergenic
923463380 1:234226934-234226956 GTGCGCGCACGCCAGTGCAGGGG - Intronic
923480357 1:234377795-234377817 GTGCGTGCATGGGTCTGCAGAGG + Intronic
923530853 1:234811048-234811070 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
923546734 1:234928793-234928815 GTGTGTGCACACCTGTGCCACGG - Intergenic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063159630 10:3409825-3409847 GTGTGTGCACAGGTGTGCACAGG - Intergenic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064430622 10:15267202-15267224 CTGTGGGCACGCATGGGCAGGGG + Intronic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1066022875 10:31319936-31319958 GTTTGTGCGCGCGTGTGCGCGGG + Intronic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1068919406 10:62466402-62466424 GTGTGTGAATGCATGAGCAGGGG - Intronic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1069653693 10:70071089-70071111 GTGTGTGCGCGTGTGCACAGGGG + Intronic
1070610657 10:77930104-77930126 GTGTGAGTGCGTGTGTGCAGGGG - Intergenic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070802688 10:79252723-79252745 GTGTGTGCAGGCATCTGCTGGGG + Intronic
1071513789 10:86283548-86283570 GTGTGTGCATGTGTGTGTAAGGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072758457 10:98036582-98036604 GTGTGTGCATGTGTGAGGAGGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074537788 10:114341031-114341053 GTGAGGGCAGGCGTTTGCAGTGG - Intronic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1077091289 11:779501-779523 GTGTGTGCACCTGTGTCCACAGG + Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077219421 11:1408980-1409002 GTGTGTGTATGTCTGTGCAGGGG + Intronic
1077223792 11:1429130-1429152 GTGTGTGTGCACGTGTGCATGGG + Intronic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1078930306 11:15907290-15907312 GTGTGTGCATGCTTGTGTATAGG - Intergenic
1080073862 11:28124393-28124415 GTGTCTGCACTCCTCTGCAGAGG - Intronic
1080333766 11:31173723-31173745 GTGTGTGTAAGTGTGTGAAGAGG - Intronic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1080999416 11:37650038-37650060 GTGTGTGTATGCATGTGTAGGGG - Intergenic
1081644442 11:44779830-44779852 ATGTGTGCATGTGTGTGCATAGG - Intronic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1081994980 11:47358558-47358580 GTGTGTGAGCAAGTGTGCAGAGG - Intronic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1086482672 11:87259396-87259418 ATGTGTGTACGCGTGTAGAGCGG + Intronic
1086911357 11:92476091-92476113 GTGTATACAAGTGTGTGCAGGGG + Intronic
1086924818 11:92628858-92628880 GTGCATGCACGTGTGTGCACAGG + Intronic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1087232657 11:95683632-95683654 GTATATGCATGCGTGTGTAGGGG - Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088566672 11:111179952-111179974 GTGTGTGTACATGCGTGCAGTGG + Intergenic
1088566745 11:111180602-111180624 GTGCGCGCACGCGTGTGGTGGGG - Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1088920910 11:114259312-114259334 GTGTGTGTACACGTGTCCTGGGG - Intronic
1088990586 11:114950142-114950164 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1089153769 11:116385197-116385219 GTGTGTGCCTGCATGTGCATGGG - Intergenic
1089270086 11:117296108-117296130 GTGTGTGCAAACGTGAGTAGAGG - Intronic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089584500 11:119501941-119501963 GTGTGTGAACGCGTGTGTGTGGG - Intergenic
1089610030 11:119663958-119663980 GTGTGTGCACGTGTCAGCAGAGG + Exonic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1089730007 11:120513389-120513411 GTCTGTGCTCGCGTGGTCAGGGG + Intronic
1090270711 11:125384082-125384104 ATGTGTGCATGCGAGTGCATGGG - Intronic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1090975473 11:131676461-131676483 CTGTGTACATGCGTGTGCGGGGG + Intronic
1091225154 11:133952522-133952544 TTGTGTGCACGTGCGTGGAGTGG - Intronic
1091670332 12:2447800-2447822 GTGTGTGCATGTGGGAGCAGTGG - Intronic
1091681212 12:2528492-2528514 GGGTGTGCACAAGTGTGCAGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092144531 12:6205323-6205345 GTGAGTGTGAGCGTGTGCAGAGG - Intronic
1092262660 12:6960787-6960809 GTGTCTGCAGCCGGGTGCAGGGG - Exonic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1094738664 12:33263630-33263652 GTGTGTGCATGTGTTTTCAGTGG + Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1098636252 12:72787434-72787456 GTGTGTGTGCACGTGTGCAGAGG + Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1100150453 12:91730360-91730382 GTGTGCGCGCACGTGTGCATGGG + Intergenic
1101724952 12:107381317-107381339 GTGTGTTCACCTGTCTGCAGAGG - Intronic
1102419412 12:112792064-112792086 GTGTGTCTACGTGTGTGCACTGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102661762 12:114535075-114535097 GTGTGTACACGCATATGCACAGG + Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102743610 12:115230520-115230542 GTGTCTGCGCGTGTGTGCAAGGG - Intergenic
1103910771 12:124350835-124350857 GTGTGGACACGCGTGTGCATCGG - Intronic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1104981432 12:132574649-132574671 GTGTTCACACGCGTGTGCACGGG + Intronic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1105576928 13:21662295-21662317 GTGTGTGCCCTCTTGAGCAGTGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106430851 13:29679069-29679091 GTGTGTGTATGTGTGTGGAGAGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106585746 13:31054880-31054902 GTGTGTGTATGCATGTGCACAGG - Intergenic
1106594862 13:31127353-31127375 GTGTGTGCATGCATATGCATGGG + Intergenic
1106897195 13:34316454-34316476 GTGTGTGCACGTGTGGCAAGGGG + Intergenic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107681426 13:42855870-42855892 GTGTGTGCACACGTGCACATGGG - Intergenic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1107934436 13:45333426-45333448 GTGTGTGCACACAGGTGGAGTGG - Intergenic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1109521194 13:63512271-63512293 GTGTGAGCAAGTGAGTGCAGGGG - Intergenic
1111739819 13:92189574-92189596 GTGTGTGCACGTGTATGGAAAGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1113450942 13:110408774-110408796 GTGTGTGTACGCGTGTCATGTGG - Intronic
1113459941 13:110474939-110474961 GTGTGTGATCGTGTGTGCACAGG - Intronic
1113483057 13:110635673-110635695 GTGTGAACACGGGTGTGCACGGG - Intronic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113799851 13:113080687-113080709 GTGTGTGAGGGCGTGGGCAGGGG + Intronic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113893857 13:113751314-113751336 GTGAGTGCATGTGTGTGCATGGG + Intergenic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1118328643 14:64799121-64799143 GTGTGTGCATGCATGTTCATGGG + Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1119853545 14:77883004-77883026 GTGTGTGCACACATGTGCGAAGG - Intronic
1122020710 14:98835753-98835775 GTGTGAGCATGAGTGTGTAGGGG - Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1122259285 14:100503071-100503093 GTGTGTGCATGCGCATTCAGAGG + Intronic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122612053 14:102991644-102991666 GTGTGTGTACACATGTGGAGAGG + Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1124556548 15:30731254-30731276 GTAGGTGCAAGCGTATGCAGTGG + Intronic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1125476394 15:40050744-40050766 GTGTGTGTGCGCGTGTGAGGGGG + Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1127114192 15:55708112-55708134 GTCTGTGCACGCCTGTGGAAAGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127638223 15:60891310-60891332 GTGTGTGTGCATGTGTGCAGTGG + Intronic
1128372480 15:67050496-67050518 GTGTGTGCACGGGTGCACATGGG - Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1130371062 15:83285242-83285264 GTGTGTGTGTGCGTGTGCGGTGG - Intergenic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132565106 16:618597-618619 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565143 16:618841-618863 GTATGTGCAGGCATGTGCACAGG + Intronic
1132565162 16:618961-618983 GTGTGTGCAGGCATTTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565217 16:619332-619354 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132691010 16:1181965-1181987 CTGTGTGCATGCGTGTGCGAGGG - Intronic
1132692183 16:1186561-1186583 GTGTGTGGGCACGTGTGCAGAGG - Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134373060 16:13643726-13643748 GTGTGTGCATGCCTGTGGGGAGG + Intergenic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1136377515 16:29874038-29874060 GTGTGTGCAGAGGTGTTCAGAGG - Intronic
1136537891 16:30911046-30911068 CTGTGTGCACGCGTGTGTCTGGG - Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136938142 16:34495260-34495282 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1136961672 16:34853297-34853319 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137849515 16:51725241-51725263 GTGTGTGTGTGTGTGTGCAGTGG - Intergenic
1138340534 16:56286189-56286211 GTGTGTGCAGATGTGTGTAGCGG - Intronic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1139429215 16:66902095-66902117 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1139641781 16:68296847-68296869 ATGTGTGCATGCGCATGCAGAGG + Intronic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141567511 16:84913057-84913079 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141928870 16:87187164-87187186 ATGTGTGCATGTGTGTGGAGGGG + Intronic
1141928981 16:87188206-87188228 ATGTGTGCACGTGTGAGTAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1142351330 16:89582069-89582091 GTGTGTGAGCACGTGTGCTGTGG + Intronic
1142363631 16:89638687-89638709 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142477421 17:197693-197715 GTGTGTACATGTGTGTGTAGTGG + Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1143433991 17:6909134-6909156 GGGTGTGCACACATGTGCACTGG + Intronic
1143601216 17:7947526-7947548 GTGGGTGCAAGTGTGTTCAGGGG - Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144777528 17:17792361-17792383 TTGTGTGCACGCATGTGCGTGGG + Intronic
1145253674 17:21311036-21311058 ATGTGTGCATGCGTGTTCACAGG - Intronic
1145322912 17:21776925-21776947 ATGTGTGCACGCGTGTTCACAGG + Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147585525 17:41652134-41652156 GTGTGTGCATGCGTGTGTGTTGG - Intergenic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148736987 17:49870388-49870410 GTGTGTGCACGATTGTGAGGCGG + Intergenic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149992685 17:61391644-61391666 GTGTGTGCAGGCGTGGGTACGGG + Intronic
1150504941 17:65689053-65689075 GTGTGTGCAGCCAGGTGCAGTGG - Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151512407 17:74569334-74569356 GTGCGTGCATGTGTGTGGAGGGG + Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191887 17:78893139-78893161 GTGCGTACATGTGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152273678 17:79341244-79341266 GTGTGTACATGTGTGTGCACAGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152289170 17:79429119-79429141 TGCTGTGCACACGTGTGCAGAGG + Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152466691 17:80470679-80470701 GTGTGCGTGTGCGTGTGCAGGGG + Exonic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1159944739 18:74435922-74435944 GTGTGTGCACATGAGTGCACGGG - Exonic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1159982147 18:74795939-74795961 GTGTGTGCGCGTGTGCACAGCGG - Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160962404 19:1729084-1729106 GTGTGTGCATGCGTGTGAGAGGG + Intergenic
1161251673 19:3284181-3284203 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1162778549 19:12995105-12995127 GTGTGTGTGCCCGTGTGTAGGGG + Intergenic
1163091055 19:15020825-15020847 GTGTGGGCAGGAGAGTGCAGGGG - Intronic
1165060574 19:33203154-33203176 GTGTGAGCACTCGTGTGAACAGG + Intronic
1165171522 19:33895158-33895180 GTGTGTGCACGGCATTGCAGTGG - Intergenic
1165196515 19:34108214-34108236 GTGTGTCCACACGTGTGGTGGGG + Intergenic
1165211136 19:34236755-34236777 GGGTGTGGGCGAGTGTGCAGAGG - Intergenic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1165894352 19:39132530-39132552 GTGGGGGCACGCGTGTGCGTGGG - Intronic
1166302186 19:41917608-41917630 GTGTGTGCATGCGGGGGCGGCGG - Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
924991869 2:319387-319409 GTGTGTGCAGGCGTGTGTGCAGG + Intergenic
924991880 2:319445-319467 GTGTGTGCAGGCGTGTGTGCGGG + Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925406954 2:3612243-3612265 ATGTGTGCATGCGTGTGCGTGGG - Intronic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927779607 2:25928854-25928876 GTGCGTGTGCGTGTGTGCAGGGG - Exonic
927917106 2:26944387-26944409 GTGTGTGCATGCATGTGTATGGG - Intronic
928269664 2:29844854-29844876 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929543443 2:42840450-42840472 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931176451 2:59859614-59859636 GTGTGTGCATATGTGTGAAGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
933009945 2:77048229-77048251 GTGTGTGCATGTGTGTGTAATGG + Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934856601 2:97733727-97733749 GTGTGGGCACATGTGTGCACAGG - Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
935430165 2:102967378-102967400 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG + Intergenic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
937260837 2:120586089-120586111 GTGTGTGTTGGGGTGTGCAGGGG + Intergenic
937265688 2:120613497-120613519 GTGCACGCACGCGTGTGCTGGGG - Intergenic
937300829 2:120840404-120840426 GTGCATGCACGCGTGTGCATGGG + Intronic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938639668 2:133266117-133266139 GTGTGTGCGCGCCTGTAGAGCGG + Intronic
939312995 2:140509057-140509079 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941574405 2:167212908-167212930 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
942182385 2:173392587-173392609 ATGCGTGCATGCGTGTGCACAGG - Intergenic
942425126 2:175852089-175852111 GTGTGTATGCGCGTGTGTAGGGG - Intergenic
942448594 2:176094374-176094396 GTGTGTGTGTGCGTTTGCAGGGG - Intronic
943107592 2:183566137-183566159 GCGTGTGCACTGGAGTGCAGTGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
946311069 2:218882978-218883000 GTGTGTGTGCCTGTGTGCAGTGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947744946 2:232502638-232502660 GTGTGCGCACGCGTGTGTGCAGG + Intergenic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
949059829 2:241950280-241950302 GTGTGAGCACAGGTGTGCATGGG + Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1170709847 20:18780784-18780806 GTGTGTATATGCGTGTGCAGAGG - Intergenic
1170821501 20:19758685-19758707 GGGTGTGCGTGCGTGTGCACCGG + Intergenic
1170933238 20:20787825-20787847 GTGTGTGCACGCCTGTGTGTGGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171183491 20:23108491-23108513 GTGTGTGCACGTAGGTGCACAGG + Intergenic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1173418991 20:42883919-42883941 GTGTGTGCATGCCTGTGTACTGG - Intronic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1173657018 20:44706458-44706480 GTGTGTGCTGCCGTGTGCAGAGG + Intergenic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1173997516 20:47350241-47350263 GTGCGTGCATGTGTGTGCACGGG - Intronic
1174304983 20:49608675-49608697 GTGTGTGGACTCGTTTGCAGAGG - Intergenic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1175404694 20:58718488-58718510 GTGAGTGCATGCGTGTGCACTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175872600 20:62215582-62215604 CGGTGTGCAGGTGTGTGCAGGGG + Exonic
1175932764 20:62500595-62500617 GCGTGTGAGGGCGTGTGCAGGGG + Intergenic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176196771 20:63840504-63840526 CTGTGTGCACCCATGTGTAGTGG + Intergenic
1178706078 21:34874147-34874169 GTGTGTGTGCGTGTGTGCAAGGG - Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179583651 21:42361246-42361268 GTGTGTGCTGCTGTGTGCAGGGG + Intergenic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181495349 22:23284458-23284480 GTGTGTGCACGCCTATGCCGAGG - Intronic
1182012647 22:27013310-27013332 GTGTGTGCACGAGTGTGACAGGG + Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183186670 22:36295406-36295428 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1184264730 22:43341076-43341098 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
1184379457 22:44136047-44136069 GTGTGTGCACGGGACTGAAGAGG - Intronic
1184457172 22:44617226-44617248 CTGTGTGTACGCGTGTGGTGTGG - Intergenic
1184779449 22:46639500-46639522 TTGTGTGTGAGCGTGTGCAGTGG + Intronic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185068027 22:48641667-48641689 GTGTGCACACGCGTGTGCGAGGG - Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185233032 22:49694159-49694181 GTGGGTGCAGGTGAGTGCAGGGG - Intergenic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
1185299251 22:50070968-50070990 GTGTGTGCAAGAGTGTGCCCTGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
950105629 3:10386568-10386590 GTGTGTGTGCGCGTGCGCATGGG - Intronic
950139653 3:10606597-10606619 GTGGGTGGACGTGTGTGCAGCGG + Intronic
950794463 3:15499276-15499298 GTGTGTCCATGCTTGTGCACTGG - Intronic
951479999 3:23150284-23150306 TTGTGTGTGCGTGTGTGCAGTGG + Intergenic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953110942 3:39937437-39937459 GTGTCTGCACCCATGTCCAGAGG - Intronic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
954815040 3:53273603-53273625 GTGTGTGTGCACGTGTGCACAGG + Intergenic
955121366 3:56062636-56062658 GTGTGTTCATGTGTGTGCAATGG - Intronic
956129180 3:66038452-66038474 GAGTGCGCGAGCGTGTGCAGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
957363391 3:79188537-79188559 GTGTGTGTGTGCGTGTGCAAAGG - Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
959034276 3:101342281-101342303 GTATGTGCATGCATGTGCACAGG + Intronic
959778418 3:110199344-110199366 GTGTGTGCACACAGGTGCACTGG - Intergenic
959959195 3:112277006-112277028 GTGTGTGCAAATGTGTGCATGGG + Intronic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960084019 3:113571481-113571503 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961793734 3:129394551-129394573 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793750 3:129394686-129394708 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
961810039 3:129516612-129516634 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
963448725 3:145449208-145449230 GTGTGTGCACGCGTGCACCATGG + Intergenic
964812887 3:160684549-160684571 GTGTGTGTGCGCATGTGTAGCGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967102168 3:186224499-186224521 GTATGTGCACTCGAATGCAGGGG + Intronic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
968447547 4:659730-659752 GTGTGTGCTCACATGTGCACAGG + Intronic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968950049 4:3685956-3685978 ATGTGTGCACACGTGTGTGGGGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301432 4:6299573-6299595 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301444 4:6299645-6299667 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301452 4:6299693-6299715 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301465 4:6299770-6299792 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969421086 4:7096222-7096244 GTGTGTGCATGCGTTGGCACTGG + Intergenic
969543894 4:7811420-7811442 GTGAGTGTGTGCGTGTGCAGAGG - Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
969962911 4:10964225-10964247 GTGTGTGCACACGTGAACACAGG + Intergenic
973199669 4:47485842-47485864 GTGTATGCCCGCGTGTACAAAGG - Intronic
973263668 4:48188894-48188916 GTGTGTGCGCGCATATGCATGGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976800698 4:88988225-88988247 GTGTGCACACCCATGTGCAGGGG - Intronic
977070837 4:92384149-92384171 GTGTGTGTCTGCGTGTGAAGTGG + Intronic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
979831905 4:125315086-125315108 GTGTGTGCATGCCTGTGCGGCGG + Intergenic
980739841 4:136935829-136935851 GTGTGTGTATGCGTGTGGAGGGG - Intergenic
983562846 4:169118206-169118228 GTGTGTGCATGCATGTACATGGG - Intronic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985564856 5:610424-610446 GTATGTGCAACAGTGTGCAGGGG - Intergenic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
985681948 5:1260269-1260291 GTGTGTGCACAGGTGTGCAAGGG - Intronic
985730591 5:1545497-1545519 ATGTGTGCAGGTGTGTGCACAGG - Intergenic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985842016 5:2313841-2313863 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987381266 5:17288092-17288114 GTGTGAGAAGGGGTGTGCAGTGG - Intergenic
987827206 5:23047536-23047558 TTGTGTGCATGCATGTGAAGAGG + Intergenic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
989558332 5:42822706-42822728 ATGTGTGCATGCATGTGCATTGG + Intronic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
989983837 5:50672844-50672866 GTGTGTGCAGGGGTGAGGAGGGG + Intronic
990355240 5:54960419-54960441 GGTTGTGCAGGTGTGTGCAGTGG - Intergenic
990944645 5:61237185-61237207 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
991579672 5:68141169-68141191 ATGTGTGTACATGTGTGCAGGGG - Intergenic
993107574 5:83616849-83616871 GTGTGTGTATTCGTGTGCACAGG + Intergenic
993134874 5:83947389-83947411 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
993358649 5:86946093-86946115 GTGTGTGCATGCATATGAAGTGG - Intergenic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
993617911 5:90136157-90136179 GTGTGTGGACGAGTGAGCACAGG + Intergenic
994580094 5:101630761-101630783 GTGTGTGTACACGTTTGCACAGG + Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995936151 5:117517521-117517543 GTGTGTGCGCCTGTGTGCAAAGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
997725586 5:136117499-136117521 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
997802819 5:136883864-136883886 CTGTTTACAGGCGTGTGCAGAGG + Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001443221 5:171762196-171762218 GTGTGTGCACACGTGTGTCCTGG - Intergenic
1001799602 5:174531530-174531552 GTGTGTGCACACCTGTGCCTGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002567829 5:180121772-180121794 GTCTGTACACACGTGTGCGGTGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002840619 6:902272-902294 GTGTGTGCATGTGTGTTGAGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011109648 6:83822922-83822944 ATTTGTGCACGAGTGTTCAGAGG - Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1013297030 6:108766834-108766856 CTGTGTGCAGGCATATGCAGAGG - Intergenic
1014189915 6:118483420-118483442 GTGTGTGCATGCATGTGTATGGG + Intronic
1014493357 6:122089765-122089787 GTGTGGGCCCGCATGTGAAGGGG - Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016273992 6:142326791-142326813 GTGTGTGTATGTGTGTGGAGGGG + Intronic
1018165447 6:161090270-161090292 TTGTGTGCACTCGTGTGTAAGGG + Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018427188 6:163694154-163694176 ATGTGTGAACGCTTGTGGAGAGG + Intergenic
1019067664 6:169315977-169315999 GTGTGTGAACTAGTGTGCAGAGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1019275999 7:176054-176076 GTGTGTGTGTGCGTGTGCACAGG + Intergenic
1019339836 7:503731-503753 GTGCCTGCAGGCGTGTGAAGTGG + Intronic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553836 7:1618785-1618807 GTGTGTGTAGGTGTGTGGAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553882 7:1619100-1619122 GTGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1019790938 7:3013503-3013525 GTGTGTCCATGGATGTGCAGAGG - Intronic
1020033019 7:4946194-4946216 GTGTGTGCATGCGTGTGTGTGGG - Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021991231 7:26143239-26143261 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024752622 7:52486214-52486236 GTGTGTGTGTGCGTGTGTAGAGG - Intergenic
1026426433 7:70298933-70298955 GTGTGTGCACCCGTGTGGGCTGG - Intronic
1026651504 7:72219662-72219684 GTGTATGCATGTGTGTGCAAGGG - Intronic
1028889198 7:95967902-95967924 GTATGTGCATGCTTGTGCGGGGG + Intronic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032023379 7:128422280-128422302 GTGTGTGTAAGTGTGTGTAGGGG + Intergenic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1032743127 7:134759574-134759596 ATGTGCGCATGTGTGTGCAGGGG + Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1033927271 7:146478673-146478695 GTGTGTGTACATGTGTGTAGAGG - Intronic
1033983674 7:147196809-147196831 GAGTGTGCAGGCGAGTGCAATGG + Intronic
1034278216 7:149833572-149833594 GTGAGGGCACGCGTGTGAAGTGG + Intergenic
1034400393 7:150857958-150857980 GGGTGTGCAGGCGAGTGCCGTGG - Exonic
1034526847 7:151669765-151669787 GTGCGTGCAAGTGTGTGCACAGG - Intronic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035189698 7:157155182-157155204 GTGTGTGTGTGCGTGTGGAGGGG - Intronic
1035288318 7:157820627-157820649 GTGTGTGTGCACGTGTGTAGGGG - Intronic
1035721720 8:1797780-1797802 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1037133405 8:15433557-15433579 GTGTGTGTATACGTGTGAAGGGG - Intronic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1037723124 8:21461502-21461524 GTGTGTGCGCACATGTGCATGGG - Intergenic
1038097887 8:24336044-24336066 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039224288 8:35371171-35371193 GTGTGTGTGTGTGTGTGCAGTGG - Intronic
1039550926 8:38442379-38442401 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1041035945 8:53790654-53790676 GAGTGTGCTGGCATGTGCAGTGG - Intronic
1041392249 8:57357627-57357649 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1042741543 8:72052940-72052962 GTGTGTGCATGTGTGGGAAGTGG + Intronic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1045189521 8:99869043-99869065 GTGTGTGCATGCGGCTGCACGGG - Intronic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1046403924 8:113747467-113747489 GTGTGAGCACACGTATGCATTGG - Intergenic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1049251905 8:141593726-141593748 GTGTGTGTGCATGTGTGCAGGGG + Intergenic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050187564 9:2991067-2991089 ATGTGTGCACCCGTGTGAACAGG - Intergenic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052663951 9:31470661-31470683 GTGCGTGCTTGTGTGTGCAGTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053348461 9:37395452-37395474 GTGTGAGCACGTGGGGGCAGAGG + Intergenic
1054948553 9:70823558-70823580 GTGCATGCACACGTGTGCATTGG - Intronic
1055049756 9:71966590-71966612 TTGTGTGCATACGTGTGCACAGG + Intronic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1057786059 9:98087992-98088014 GGGCGTGCGCGCGTCTGCAGGGG + Exonic
1058454568 9:105127172-105127194 GTGTGTGTGTGCATGTGCAGGGG - Intergenic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1059962013 9:119574774-119574796 GTGTGTACACGCATATGAAGTGG - Intergenic
1060378445 9:123140825-123140847 GTGTGTGCATGATTGTGCACAGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061330568 9:129889864-129889886 GTATGCGCACGCGTGTGTACTGG + Exonic
1061408274 9:130404639-130404661 GTGTGTGTACACGTGTGCACAGG + Intronic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062049793 9:134441364-134441386 GTGTGTGCATGCGTATGAATGGG - Intergenic
1062187522 9:135226540-135226562 GTGTGTGAATGTGTGTGCAATGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062205970 9:135337559-135337581 GTGTATGCACATGTGTGCAGGGG + Intergenic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG + Intronic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185776543 X:2807858-2807880 GTGTGTGCATGTGTGTCCATGGG + Intronic
1186398684 X:9236453-9236475 GTGTGAGAACATGTGTGCAGAGG + Intergenic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1191076854 X:56463216-56463238 GTGTGTGCACCCCAGTGGAGGGG - Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192193794 X:69015451-69015473 GTGTGAGCACATGTGTGTAGTGG + Intergenic
1192483913 X:71508756-71508778 GTGTGTGCGCGCATATGCATAGG + Intronic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1195307805 X:103602981-103603003 GTGTGTGTGCACGTGTGCACTGG - Intergenic
1195328888 X:103780461-103780483 GTGTGTGTGCGCGTCTGAAGAGG + Intronic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1200167339 X:154045930-154045952 GTGTGTGTGTGTGTGTGCAGGGG + Intronic