ID: 1152201175

View in Genome Browser
Species Human (GRCh38)
Location 17:78947299-78947321
Sequence GCTGGAGCCGAGTCCAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152201175_1152201177 -7 Left 1152201175 17:78947299-78947321 CCGGCTTTGGACTCGGCTCCAGC No data
Right 1152201177 17:78947315-78947337 CTCCAGCCAGCTGGTTCTGAAGG No data
1152201175_1152201180 4 Left 1152201175 17:78947299-78947321 CCGGCTTTGGACTCGGCTCCAGC No data
Right 1152201180 17:78947326-78947348 TGGTTCTGAAGGAAGTGCTCAGG No data
1152201175_1152201181 5 Left 1152201175 17:78947299-78947321 CCGGCTTTGGACTCGGCTCCAGC No data
Right 1152201181 17:78947327-78947349 GGTTCTGAAGGAAGTGCTCAGGG No data
1152201175_1152201182 6 Left 1152201175 17:78947299-78947321 CCGGCTTTGGACTCGGCTCCAGC No data
Right 1152201182 17:78947328-78947350 GTTCTGAAGGAAGTGCTCAGGGG No data
1152201175_1152201183 11 Left 1152201175 17:78947299-78947321 CCGGCTTTGGACTCGGCTCCAGC No data
Right 1152201183 17:78947333-78947355 GAAGGAAGTGCTCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152201175 Original CRISPR GCTGGAGCCGAGTCCAAAGC CGG (reversed) Intergenic
No off target data available for this crispr