ID: 1152201223

View in Genome Browser
Species Human (GRCh38)
Location 17:78947540-78947562
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152201216_1152201223 1 Left 1152201216 17:78947516-78947538 CCATGCTCAGCAAAGCTTTATGT No data
Right 1152201223 17:78947540-78947562 CCAAAGCTGCGGGACGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152201223 Original CRISPR CCAAAGCTGCGGGACGGGGC TGG Intergenic
No off target data available for this crispr