ID: 1152201699

View in Genome Browser
Species Human (GRCh38)
Location 17:78951010-78951032
Sequence TTGGAGGATCCATTTCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152201699_1152201705 12 Left 1152201699 17:78951010-78951032 CCATCTTGAAATGGATCCTCCAA No data
Right 1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152201699 Original CRISPR TTGGAGGATCCATTTCAAGA TGG (reversed) Intergenic
No off target data available for this crispr