ID: 1152201705

View in Genome Browser
Species Human (GRCh38)
Location 17:78951045-78951067
Sequence CTGTCCCAGCTGATGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152201701_1152201705 -4 Left 1152201701 17:78951026-78951048 CCTCCAATTCCCAGGTGAGCTGT No data
Right 1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG No data
1152201702_1152201705 -7 Left 1152201702 17:78951029-78951051 CCAATTCCCAGGTGAGCTGTCCC No data
Right 1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG No data
1152201699_1152201705 12 Left 1152201699 17:78951010-78951032 CCATCTTGAAATGGATCCTCCAA No data
Right 1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG No data
1152201697_1152201705 25 Left 1152201697 17:78950997-78951019 CCACGTAGGTGAGCCATCTTGAA No data
Right 1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152201705 Original CRISPR CTGTCCCAGCTGATGCCATG TGG Intergenic
No off target data available for this crispr