ID: 1152202457

View in Genome Browser
Species Human (GRCh38)
Location 17:78955047-78955069
Sequence CCACGTTCCCACCTGGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152202450_1152202457 10 Left 1152202450 17:78955014-78955036 CCTTCATTCATTCAGCAAAGACT No data
Right 1152202457 17:78955047-78955069 CCACGTTCCCACCTGGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152202457 Original CRISPR CCACGTTCCCACCTGGTGCC GGG Intergenic
No off target data available for this crispr