ID: 1152202772

View in Genome Browser
Species Human (GRCh38)
Location 17:78956716-78956738
Sequence CTGGATGCTGGGAGTGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152202764_1152202772 8 Left 1152202764 17:78956685-78956707 CCTTGAACAGATGATGCCTGAGG No data
Right 1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG No data
1152202763_1152202772 19 Left 1152202763 17:78956674-78956696 CCAGGTGGGCTCCTTGAACAGAT No data
Right 1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG No data
1152202768_1152202772 -8 Left 1152202768 17:78956701-78956723 CCTGAGGGATGTCGCCTGGATGC No data
Right 1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG No data
1152202761_1152202772 27 Left 1152202761 17:78956666-78956688 CCTGGAGCCCAGGTGGGCTCCTT No data
Right 1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG No data
1152202762_1152202772 20 Left 1152202762 17:78956673-78956695 CCCAGGTGGGCTCCTTGAACAGA No data
Right 1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152202772 Original CRISPR CTGGATGCTGGGAGTGAGCG AGG Intergenic