ID: 1152204306

View in Genome Browser
Species Human (GRCh38)
Location 17:78966318-78966340
Sequence GTGCCTCTGTTCACCAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152204306_1152204309 22 Left 1152204306 17:78966318-78966340 CCAGATCTGGTGAACAGAGGCAC No data
Right 1152204309 17:78966363-78966385 GTAGCCTCTCACCCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152204306 Original CRISPR GTGCCTCTGTTCACCAGATC TGG (reversed) Intergenic
No off target data available for this crispr