ID: 1152204546

View in Genome Browser
Species Human (GRCh38)
Location 17:78967556-78967578
Sequence CCGTGTGGATGGAGGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152204541_1152204546 -10 Left 1152204541 17:78967543-78967565 CCAATCTCAGTTTCCGTGTGGAT No data
Right 1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG No data
1152204538_1152204546 0 Left 1152204538 17:78967533-78967555 CCCGGAGTGGCCAATCTCAGTTT No data
Right 1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG No data
1152204539_1152204546 -1 Left 1152204539 17:78967534-78967556 CCGGAGTGGCCAATCTCAGTTTC No data
Right 1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG No data
1152204536_1152204546 17 Left 1152204536 17:78967516-78967538 CCTCGCTTTGGGCAGAACCCGGA No data
Right 1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152204546 Original CRISPR CCGTGTGGATGGAGGGAAGC CGG Intergenic
No off target data available for this crispr