ID: 1152209699

View in Genome Browser
Species Human (GRCh38)
Location 17:78996508-78996530
Sequence TCTCCCTGAACCCCAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152209699_1152209710 27 Left 1152209699 17:78996508-78996530 CCCCCTGCTGGGGTTCAGGGAGA 0: 1
1: 0
2: 1
3: 36
4: 291
Right 1152209710 17:78996558-78996580 AGTAACATGAAACCAAAGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 246
1152209699_1152209711 28 Left 1152209699 17:78996508-78996530 CCCCCTGCTGGGGTTCAGGGAGA 0: 1
1: 0
2: 1
3: 36
4: 291
Right 1152209711 17:78996559-78996581 GTAACATGAAACCAAAGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152209699 Original CRISPR TCTCCCTGAACCCCAGCAGG GGG (reversed) Intronic
900720662 1:4173831-4173853 TCTCCCTGAGGCTCCGCAGGAGG + Intergenic
900790134 1:4674581-4674603 GGTCCCTGAGCCCCAGCAGCTGG + Intronic
901192763 1:7422332-7422354 TCTCACCCACCCCCAGCAGGAGG - Intronic
901772651 1:11538278-11538300 ACTCCCTGAAAGCCTGCAGGAGG - Intergenic
902200525 1:14830228-14830250 TTTCCCTGAGCCGTAGCAGGTGG + Intronic
902865726 1:19277025-19277047 AATCCCTTGACCCCAGCAGGTGG + Intergenic
903264018 1:22145742-22145764 TCTCCCAGCACCCCAGGAGAAGG - Intergenic
904024907 1:27496721-27496743 TCTCCCTGACCCCCATCTGAGGG + Intergenic
904476923 1:30771194-30771216 TCTTCCTGCATCCCTGCAGGTGG - Intergenic
904598938 1:31663278-31663300 TTTCCCTGATCCCCAGCCAGAGG - Intronic
904763406 1:32821719-32821741 ACTCGCTGAAACCCAGGAGGCGG - Intronic
905146000 1:35887220-35887242 TCTTCCTGACCCCCAGCTGAGGG + Intronic
906032030 1:42729052-42729074 TCTCCATGCACTCCAGCAAGGGG + Intergenic
906448294 1:45922357-45922379 TCACCATGAACAGCAGCAGGAGG - Intronic
909502765 1:76353887-76353909 ACTCCCCAAACCCAAGCAGGTGG + Intronic
909679592 1:78277128-78277150 TCTCCCTGAAATCCTCCAGGAGG + Intergenic
909829880 1:80174532-80174554 TGTCCCAGAAACCAAGCAGGTGG + Intergenic
912443001 1:109712973-109712995 TCTCCCTGAACCCTGGGATGTGG + Intronic
912854301 1:113153381-113153403 TCTCCCTGGCCCCCAGCTTGTGG - Intergenic
913046377 1:115076778-115076800 TCTCCTTGAGCCCCAGAAGAAGG - Intronic
915297313 1:154930372-154930394 ACTGCTTGAACCCCAGGAGGTGG + Intronic
919452566 1:197788397-197788419 TCTCAGTGAACCCCAGCACGAGG - Intergenic
919920289 1:202163218-202163240 TCTCCCTGAACCCGGGCTGCCGG + Intergenic
920228912 1:204457522-204457544 TCTCCCTCAACCTCAGGAAGAGG + Intronic
920253087 1:204635474-204635496 TCTCCCTTAAACCCTGCAGCAGG - Intronic
920255644 1:204652295-204652317 CCTCCCTGAACCACAGCTGCAGG + Intronic
920311188 1:205049230-205049252 TTTCCCTGAAACCCACCAGGAGG - Intronic
920403247 1:205690466-205690488 TGGCCCTGAAGCCCAGCAGAGGG - Intergenic
920529723 1:206693080-206693102 TCTCCCTGTAGACAAGCAGGAGG - Intronic
921634693 1:217477888-217477910 TCTCCTTGAACACCACCAGAAGG - Intronic
922857808 1:228790154-228790176 TCTACCTTCGCCCCAGCAGGAGG - Intergenic
923097660 1:230788388-230788410 CCTCCCCTGACCCCAGCAGGTGG - Intronic
923249397 1:232166193-232166215 CCTGCCTGAACTCCAGCATGTGG + Intergenic
923629524 1:235640751-235640773 TCTTCCTGGAGCCCTGCAGGGGG - Intronic
1063017649 10:2094684-2094706 GGTCCCTCAACCCCAGCAGCAGG + Intergenic
1063111165 10:3038601-3038623 CCTCCCTGATCCTCAGCACGTGG + Intergenic
1065739342 10:28783143-28783165 CCTCCCTGTAGCCCAGCATGTGG - Intergenic
1067246407 10:44550322-44550344 TCTCACTGACACCAAGCAGGAGG + Intergenic
1067945253 10:50684953-50684975 TGTCCCTGACCCCCAACAAGGGG + Intergenic
1069099116 10:64296182-64296204 TGTCCCTGTGCCCCAGTAGGTGG + Intergenic
1069703378 10:70441808-70441830 TCTCGCCCATCCCCAGCAGGAGG - Intronic
1069855777 10:71440189-71440211 AGTCCCTGCACCCCAGGAGGAGG - Intronic
1069981736 10:72257363-72257385 TCTCCCTGACCCCTCCCAGGCGG - Intergenic
1070584208 10:77748789-77748811 GCTCCCTGAAACCCAGCAGTGGG - Intergenic
1071258512 10:83896988-83897010 ACTCCCTCAAACCCAGCAGACGG - Intergenic
1072797861 10:98370079-98370101 CCTCTCTCAACCTCAGCAGGAGG + Intergenic
1072906328 10:99457477-99457499 TCTCCCTGAGCCCCTACATGGGG + Intergenic
1073229064 10:101951779-101951801 AATCCCTGGAACCCAGCAGGTGG + Intronic
1074191996 10:111146192-111146214 CCTTCCTGAACAGCAGCAGGAGG - Intergenic
1075653758 10:124147534-124147556 TCTGCCTGAACCCCAGGAGGTGG - Intergenic
1075879605 10:125839414-125839436 GATCACAGAACCCCAGCAGGTGG - Intronic
1075973269 10:126673033-126673055 TCTCCCTTGACCACAGCTGGTGG + Intergenic
1076214222 10:128679830-128679852 TCTTCCACAACCCCAGCCGGAGG - Intergenic
1077106929 11:846206-846228 CCTCTCTGAGCCCCAGCAGCAGG - Intronic
1077811482 11:5642278-5642300 TCTCCCTGAGCCTGAGGAGGGGG - Intronic
1078475413 11:11624990-11625012 TCACAATGATCCCCAGCAGGAGG - Intergenic
1081511878 11:43782919-43782941 TCTCACTGCATCCCATCAGGTGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081683620 11:45026253-45026275 TCACCCTGAGCCCCAGCTGTCGG + Intergenic
1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG + Intergenic
1081998129 11:47377666-47377688 TCTCCCTGAACTCCAGCCCTGGG + Intronic
1082988326 11:59186457-59186479 GCTCCCAGCTCCCCAGCAGGGGG - Intronic
1083722647 11:64611091-64611113 TCTCCCTAACCTCCAGCAGTGGG + Intronic
1083860247 11:65416554-65416576 TGTCCCTGCAGCCCGGCAGGAGG - Intergenic
1084089699 11:66871480-66871502 TCTCCCTGACCCCCACCTGCAGG - Exonic
1084731306 11:71075462-71075484 TCTCCCTGATCCACAGCCAGGGG - Intronic
1084734794 11:71097673-71097695 GCTCCCGGAAGCGCAGCAGGAGG + Intronic
1085479604 11:76810237-76810259 GCTCCCTGAACCCCAGCCTCAGG - Intergenic
1085517801 11:77121654-77121676 TCACCCATAACGCCAGCAGGGGG + Intronic
1089082634 11:115789703-115789725 TCTGCCTGGACCCCAGGATGGGG + Intergenic
1089178857 11:116567137-116567159 TCTCCCTGAGGACCAGAAGGGGG + Intergenic
1089757086 11:120695129-120695151 GCTCCCTGACCTCCAGCAGGAGG - Intronic
1089905644 11:122035493-122035515 TCTCCCTGCCACCCAGCATGTGG + Intergenic
1090422685 11:126586401-126586423 TCTCACTGAACGCGAGCTGGGGG + Intronic
1097100966 12:56589026-56589048 CCTCCCTGCCCCCCAGCATGTGG - Intronic
1097166134 12:57087650-57087672 TCTCCCCGGACCCCACAAGGCGG + Intronic
1097690306 12:62728691-62728713 TCTCCCTGAGCCCAGGAAGGTGG - Intronic
1099580913 12:84446062-84446084 CCACCCCAAACCCCAGCAGGAGG + Intergenic
1101563951 12:105887349-105887371 TCTCCCTGCATCACATCAGGGGG - Intergenic
1102346324 12:112163460-112163482 TCACCCTCAACTCCAGCAGCAGG - Intronic
1103298143 12:119905846-119905868 TCTCCCTGAAACCCTGAAGTTGG - Intergenic
1103343609 12:120234865-120234887 TCTCCCTTAAGGCCAGCAGGGGG + Intronic
1103526704 12:121574081-121574103 GCTCCCTGAGCACCTGCAGGTGG - Intronic
1104154703 12:126120244-126120266 TCTCCATGACCCCCAGCTGCTGG + Intergenic
1104417315 12:128606230-128606252 ACTTCCTGAAGCACAGCAGGTGG - Intronic
1105327593 13:19384175-19384197 GCTCCCTGAACCCCCTTAGGTGG + Intergenic
1105864309 13:24445503-24445525 GCTCCCTGAACCCCTTTAGGTGG - Intronic
1108487458 13:50941419-50941441 ACTCCCTGAGCCCCACTAGGAGG - Intronic
1112034693 13:95486222-95486244 TCTCCCTCAACTCCTGCAAGTGG + Intronic
1119322860 14:73741909-73741931 TCACCCTCACCCCCAGCAAGAGG + Intronic
1119620295 14:76126729-76126751 TACCCCTGGACCCTAGCAGGAGG - Intergenic
1122390211 14:101375057-101375079 TCTCCCAGAACTCCTGCAGTGGG + Intergenic
1122834644 14:104424846-104424868 TCTCTCTGACCCACAGCTGGTGG + Intergenic
1127364194 15:58272034-58272056 TCTACGGGCACCCCAGCAGGTGG + Intronic
1128044464 15:64605396-64605418 TCTCCATGAACCACTACAGGTGG + Intronic
1128125486 15:65189297-65189319 TCTCCCTGAACATCAGGATGAGG - Intergenic
1128183334 15:65623967-65623989 TCTCCATGAAGCCCAGCCAGGGG - Exonic
1128980850 15:72184458-72184480 TTTCCCGGGAGCCCAGCAGGTGG - Intronic
1129385191 15:75192428-75192450 CCTCCCTGCACCCCAGCATAGGG - Intergenic
1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG + Intergenic
1131131203 15:89901579-89901601 CCTCCCTGAGCCACAGCATGAGG + Exonic
1132725968 16:1338472-1338494 CCTCCGTGCACCACAGCAGGCGG - Intronic
1132850787 16:2024005-2024027 GCTCCCCGGGCCCCAGCAGGAGG - Intergenic
1133222480 16:4324771-4324793 TCTCCCTGAAACCCAACATGGGG + Intronic
1134140579 16:11714763-11714785 TGTCCCTGTACTCCACCAGGTGG - Intronic
1134141444 16:11723214-11723236 TGCCCCTGCACTCCAGCAGGTGG + Intronic
1134393298 16:13839653-13839675 TCTCCCTGGAGCCCAGCACCTGG - Intergenic
1136081219 16:27853805-27853827 TCACTCTGAACCCCACCTGGGGG - Intronic
1137288184 16:47033423-47033445 TCTGCCTCTACCCCAGCTGGGGG - Intergenic
1137774519 16:51044149-51044171 GCTGCCTGAACCCCAGCGGGTGG - Intergenic
1138530786 16:57633254-57633276 TCTCCCTAAACCTCAGCTGGAGG + Intronic
1141168787 16:81678177-81678199 CCTCCCTGAATCCCAGGATGAGG - Intronic
1141436269 16:84001545-84001567 TCCCCCTTTACCCTAGCAGGAGG - Intronic
1142364324 16:89641970-89641992 TCTGCCTGCACCCCAGGATGGGG - Intergenic
1142496555 17:309422-309444 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496575 17:309477-309499 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496600 17:309537-309559 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496622 17:309596-309618 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142496641 17:309650-309672 TATCCCAGACCCCCAGCAGGGGG - Intronic
1142496662 17:309709-309731 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142642048 17:1289857-1289879 TCTTCCTGAGTCCCAGCTGGAGG + Intronic
1143670703 17:8393748-8393770 TCACACTGGACCCCAGGAGGAGG + Intronic
1146449055 17:32957557-32957579 TCTCACTGTTCCCCAGGAGGAGG - Intergenic
1147388081 17:40093374-40093396 TCTCCCTGAAGCCCCCCAGAAGG + Exonic
1147558856 17:41496843-41496865 CCACCCTGTATCCCAGCAGGTGG + Intergenic
1147653127 17:42073049-42073071 TCCCCCTGGCACCCAGCAGGTGG - Intergenic
1148204926 17:45774258-45774280 TCACTCTGACTCCCAGCAGGAGG + Intergenic
1150764558 17:67993281-67993303 TCTCCCAGTCCCCCAGGAGGTGG + Intronic
1151766332 17:76135261-76135283 TCTCCATGGACCCCAGCAATGGG - Intergenic
1152133417 17:78490797-78490819 TCCCCCTGAACCGCACCATGAGG - Exonic
1152159534 17:78658767-78658789 TCTCCATGATCCCCGTCAGGAGG - Intergenic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1152282844 17:79395652-79395674 TCTCCCCCAACCCCAACGGGTGG + Intronic
1152386740 17:79979340-79979362 ACGCCCTGGACCCCAGCAGAGGG + Intronic
1152760109 17:82103314-82103336 CCCCCCAGGACCCCAGCAGGGGG - Intronic
1154218105 18:12430162-12430184 TCTCCTTGAACCCAAGCCAGGGG + Intronic
1155830916 18:30513969-30513991 ACTCCATGAACTGCAGCAGGAGG - Intergenic
1156018535 18:32574192-32574214 TGTCCATGGGCCCCAGCAGGTGG - Intergenic
1157491987 18:48129933-48129955 CCTCCCTGCTCCCTAGCAGGTGG + Intronic
1158901982 18:61972561-61972583 TCTCCCAGCACCCCAGGAGAAGG + Intergenic
1158936407 18:62369036-62369058 TTTCTCTGAACCCCTGGAGGTGG + Exonic
1160383569 18:78479356-78479378 TCTCCCACAACACCAGGAGGTGG + Intergenic
1160557504 18:79735679-79735701 CCTCCCCGAACCTCAGCAGGCGG - Intronic
1161030150 19:2054251-2054273 TCTCCCACAGCCCCAGCAGGTGG + Intergenic
1162106608 19:8373686-8373708 TCTCCCCTGACCCCGGCAGGAGG + Exonic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1162805526 19:13136221-13136243 TCTCCCTGCAGCCGAGAAGGTGG + Exonic
1164704251 19:30308184-30308206 TGTCCCTGAAACACAGCAGATGG - Intronic
1165146530 19:33734621-33734643 TCTCCCTGAGCTCCTGCAGTTGG - Intronic
1165533759 19:36425847-36425869 TCTCCCTGAAGCCAAGGAAGAGG + Intergenic
1167247600 19:48383146-48383168 TCCCCCTGAAACCCGGCAGGAGG + Exonic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
1167561141 19:50226754-50226776 TCTACCTGAACCCCATCCTGTGG - Intronic
1168181726 19:54666406-54666428 TCTCCCTGGACGTCAGCAGCTGG - Exonic
1168275541 19:55276028-55276050 AATCACTGAAACCCAGCAGGTGG + Intronic
1168543790 19:57233537-57233559 CACCCCTGAACCCCAGCAGCAGG - Exonic
925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG + Intergenic
925741618 2:7009863-7009885 TTCCTCTGAGCCCCAGCAGGAGG - Intronic
925768847 2:7262969-7262991 TCTCCCCTCACCCCAGCAGATGG - Intergenic
926285095 2:11482363-11482385 TCTTTCTGAACCCACGCAGGTGG + Intergenic
928217598 2:29375241-29375263 TCTCACTGACCCTCAGCATGAGG + Intronic
929811266 2:45190913-45190935 TCTGCCTGCAGCCCAGGAGGGGG - Intergenic
931184081 2:59932661-59932683 TTTCTCTGAACCCCCGAAGGTGG + Intergenic
931814714 2:65889568-65889590 TCTCCCAGTTCCACAGCAGGAGG - Intergenic
931955524 2:67419705-67419727 ACTCCCTCACCCCCACCAGGGGG + Intergenic
932284068 2:70518077-70518099 TCTCCCTGAGCCACTGCATGTGG - Intronic
932592222 2:73074384-73074406 CCTCCCTCAACCCCAATAGGAGG - Exonic
933474115 2:82766717-82766739 TCTCCATGAACCCCACCAGATGG + Intergenic
933606891 2:84392558-84392580 TCTCCCTTAACCCCAGGTTGGGG + Intergenic
933780056 2:85795086-85795108 TGACCCTGAACCCCAGCATCGGG - Intergenic
934641314 2:96028547-96028569 TGTCCCTGCAGCCCAACAGGAGG + Intronic
934699840 2:96430542-96430564 GCACCATGAACCACAGCAGGAGG + Intergenic
934767101 2:96885701-96885723 TCTCCCTGACCCCCACCAGCAGG - Intronic
936828650 2:116612648-116612670 TCTGCTTGATGCCCAGCAGGTGG - Intergenic
938007499 2:127799780-127799802 CCTGCCTGAACTCCAGCAGGAGG - Intronic
938194932 2:129319023-129319045 GGTCCATGAACCACAGCAGGAGG - Intergenic
938639360 2:133264324-133264346 TCTCCATTAATCCCAGCAGCAGG - Intronic
942155002 2:173119320-173119342 CCTCCCAGCACCCCAGCAGGTGG - Intronic
946414340 2:219532065-219532087 ACACCCCGAACCCCAGCTGGTGG - Exonic
947361215 2:229347436-229347458 TCTGCCTGAATCCCTGCAGCAGG + Intergenic
947746172 2:232508423-232508445 TCTCACTGAGCGCCACCAGGAGG + Intergenic
947828686 2:233124192-233124214 TCTTCCTGAATTCCAGCAGGTGG + Intronic
948259754 2:236594839-236594861 TCTTCCAGCACCCCCGCAGGTGG - Intergenic
1169210711 20:3764891-3764913 TCTCCCTGGCCCCCACCAAGTGG + Intronic
1169621967 20:7517334-7517356 ACTCCCTGAACTCCAGCTTGAGG - Intergenic
1169767511 20:9163385-9163407 TCTCTTAGAGCCCCAGCAGGTGG + Intronic
1170187800 20:13610881-13610903 TCTCCATGAACCACATCTGGAGG + Intronic
1170714833 20:18822651-18822673 TCCCTCTGAAACCCAGCAAGTGG - Intronic
1170958281 20:21001707-21001729 TCTGCCTGGACCCCAGCATTTGG - Intergenic
1171448399 20:25220386-25220408 ACCCCCAGAACCCCAGCAGGGGG - Intronic
1171488931 20:25503189-25503211 CCTCCTGTAACCCCAGCAGGTGG + Intronic
1171488942 20:25503246-25503268 CCTCCTGTAACCCCAGCAGGTGG + Intronic
1172704537 20:36873165-36873187 TCTCCCTGATCCCCAGAGAGGGG - Intergenic
1173864256 20:46304190-46304212 GCTGCCTGCACCCCTGCAGGAGG - Intronic
1175037639 20:56015399-56015421 TCTGCCTCACCTCCAGCAGGCGG + Intergenic
1175888167 20:62303787-62303809 TGTCCCTGAGCCGCAGCAGCAGG + Intronic
1177278310 21:18945336-18945358 TCTGCCTGGACCTCAGCAGAAGG - Intergenic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1179178909 21:39028829-39028851 TCTCCCTGACCCAGGGCAGGCGG - Intergenic
1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG + Intergenic
1179542018 21:42089184-42089206 GCTTCCTGTACCCAAGCAGGAGG + Intronic
1180924709 22:19545500-19545522 TCCCCCTGGAGCCCAGCATGTGG - Intergenic
1183686560 22:39364306-39364328 TCTCGCTGACCCACAGCAGATGG - Intronic
1184002875 22:41688323-41688345 TCCTCCTGAACCCCAGCAACGGG + Intronic
1184130749 22:42515178-42515200 TCTCTGTGGACACCAGCAGGGGG + Exonic
1184140928 22:42577008-42577030 TCTCTGTGGACACCAGCAGGGGG + Intergenic
1184368644 22:44068675-44068697 TCTGCCTGACCCCCGGCAAGAGG - Intronic
1185153571 22:49180027-49180049 GCTCCCTCAAAACCAGCAGGGGG - Intergenic
1185205914 22:49538676-49538698 TCTGGCTTAATCCCAGCAGGAGG + Intronic
949264598 3:2141769-2141791 TCTGCCTGAACACCAGTATGGGG - Intronic
950504972 3:13388967-13388989 TCTCCCTGGATCCCAGCTTGGGG + Intronic
950717711 3:14861676-14861698 TCTGCCTCAAGCCAAGCAGGGGG - Intronic
951039082 3:17968121-17968143 TATCCCTGCACCCCATCAGGGGG - Intronic
952887284 3:38019573-38019595 TCTCCCTGAGGCCTTGCAGGAGG + Intronic
952891746 3:38047023-38047045 TCTCACTGCAGCACAGCAGGAGG + Intronic
953929564 3:46999162-46999184 CCTCCCTGAACCCCAGGCAGGGG - Intronic
954388106 3:50254960-50254982 TCTCCCTTTTCCCCAACAGGTGG - Intronic
954645696 3:52130358-52130380 TCTTCCAGAGCCCCACCAGGAGG + Intronic
958658793 3:97038810-97038832 TCTGCCTGACACCTAGCAGGTGG - Intronic
959271961 3:104222799-104222821 TCTCTCTGAAAACCAGCACGAGG - Intergenic
960991768 3:123316125-123316147 TCTCCATGTACCATAGCAGGAGG - Intronic
961381547 3:126499098-126499120 TCTCACTGAGGCCCTGCAGGAGG + Intronic
961663750 3:128484002-128484024 TCTCCCTGTTCCCCTGCAGAAGG - Exonic
961839968 3:129701386-129701408 TCTTACTGAATCCCAGCAGGAGG - Intronic
964319636 3:155481621-155481643 TGTCCCTGTACCCAAGCAGTTGG - Exonic
964579280 3:158213601-158213623 TCTCTCTGAACTCCTGCAGGAGG + Intronic
966690945 3:182740842-182740864 GCTTCCTGAACGGCAGCAGGTGG + Intergenic
967560438 3:190911655-190911677 TCTCTCTTTATCCCAGCAGGTGG - Intergenic
968073702 3:195804239-195804261 TCTCCTTGAACCACGTCAGGTGG + Intronic
968553584 4:1236611-1236633 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553595 4:1236646-1236668 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553634 4:1236786-1236808 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553653 4:1236856-1236878 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553662 4:1236891-1236913 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553673 4:1236926-1236948 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553755 4:1237264-1237286 TTTCCCTGAGCCCCATGAGGAGG - Intronic
968553774 4:1237334-1237356 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553785 4:1237369-1237391 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553810 4:1237474-1237496 TTTCCCTGCACACCATCAGGAGG - Intronic
968553840 4:1237579-1237601 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553880 4:1237719-1237741 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553909 4:1237824-1237846 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553937 4:1237929-1237951 TTTCCCTGTGCCCCATCAGGAGG - Intronic
968553948 4:1237964-1237986 TTGCCCTGAGCCCCATCAGGAGG - Intronic
968553956 4:1237999-1238021 TTTCCCTGGACACCATCAGGAGG - Intronic
968704674 4:2072354-2072376 CCTCCCAGACCCCAAGCAGGGGG + Intronic
968936713 4:3614843-3614865 TCTCCCTGCCCCCCGGGAGGTGG + Intergenic
968948162 4:3676378-3676400 TGTCCCTGAGGCCCAGCAGGTGG - Intergenic
969099992 4:4761689-4761711 TCTGCCCACACCCCAGCAGGGGG + Intergenic
969108296 4:4824838-4824860 TCTGCCTGCACCCCAGCACCTGG - Intergenic
969283903 4:6190608-6190630 CCACCCCCAACCCCAGCAGGCGG + Intronic
969623293 4:8289734-8289756 CCTCCCTGCACCCAAGGAGGGGG - Intronic
970101111 4:12524020-12524042 GCCTCCAGAACCCCAGCAGGAGG + Intergenic
971019238 4:22517014-22517036 TCTCCCTGAAACATGGCAGGTGG + Intergenic
971310093 4:25518264-25518286 TCTCCAGGAACCCCATCAGTTGG - Intergenic
980733702 4:136855105-136855127 TCACTATGATCCCCAGCAGGGGG + Intergenic
980980638 4:139651779-139651801 TCTCCCTGAACGCCACCAGATGG - Intergenic
981783551 4:148452657-148452679 TCTCCCTGACTCCCAGCAGAAGG - Intergenic
985789630 5:1918639-1918661 TGTCCCTGATCCCCAGAGGGAGG + Intergenic
988561571 5:32286252-32286274 TCACCTTGAACCTCAGGAGGTGG + Intronic
989501226 5:42170583-42170605 TCTACCTGCACCCCCACAGGGGG + Intergenic
997104704 5:131005619-131005641 TCTCCCTGAGCCACCGCAGCTGG - Intergenic
997320110 5:132970886-132970908 TCTCCCTGTCACCCAGCAGCAGG - Intergenic
997364699 5:133318518-133318540 TCTCCATTTACCCCAGCAGCTGG - Intronic
997673546 5:135695701-135695723 TCTTCTTGGACCCCAGCCGGAGG + Intergenic
997943960 5:138182842-138182864 TCTCCCTGTGCCCCTCCAGGAGG + Exonic
999013477 5:148069676-148069698 TCTCCCAGAACCTCGGAAGGGGG + Intronic
1001419175 5:171573897-171573919 TCTCCCTGCTCCCTGGCAGGGGG - Intergenic
1003405190 6:5822083-5822105 GCTGCTGGAACCCCAGCAGGAGG + Intergenic
1004075212 6:12338854-12338876 GGTTCCTGAACCGCAGCAGGTGG + Intergenic
1004540066 6:16541354-16541376 TCTCCTTCCACCCCAGCAGAGGG + Intronic
1004582968 6:16972305-16972327 AATCCCTGAAACCCAGGAGGCGG + Intergenic
1006085651 6:31593086-31593108 TCTCCTTGAACCTCGGAAGGTGG - Intergenic
1006466508 6:34197742-34197764 GTTCCCTGAACCCCAGCAGAGGG - Intergenic
1007787029 6:44286488-44286510 GCTCCCGGAACACCAGCAGAAGG - Exonic
1012526659 6:100185824-100185846 TCTCCCTGAAGGGCAGCAGTTGG + Intergenic
1017673246 6:156787882-156787904 TTTCTCTGCACTCCAGCAGGGGG + Intronic
1018601569 6:165549409-165549431 ACTCCCTTAAACCCAGGAGGCGG - Intronic
1018610949 6:165647324-165647346 TCCCACTCAACCCCAGCAGCAGG + Intronic
1018926886 6:168212812-168212834 ACCTCCAGAACCCCAGCAGGAGG - Intergenic
1019442466 7:1054419-1054441 TCCACCTGAACCCCACCTGGAGG + Intronic
1019526580 7:1483157-1483179 TCCACCCGAACCCCAGCATGAGG + Intronic
1019609340 7:1929085-1929107 CCTCCCTGAGGCCGAGCAGGTGG + Intronic
1019720813 7:2569485-2569507 TCTTCCTCACCCTCAGCAGGAGG + Intronic
1020527147 7:9276339-9276361 ATTGCCTGAACCCCAGTAGGCGG - Intergenic
1022530083 7:31061538-31061560 CCTCCCTGACCCACAGGAGGAGG + Intronic
1023358044 7:39387081-39387103 TCTTCCTGTCCCCCAGCACGGGG - Intronic
1023994593 7:45151549-45151571 TGACCCTGTACTCCAGCAGGAGG + Intergenic
1026947628 7:74326486-74326508 TCTCCTGGATCCCCAGCATGAGG - Intronic
1028860817 7:95648388-95648410 TCTCCCAGGAACCCAGGAGGCGG - Intergenic
1031991642 7:128202641-128202663 TTTCCCTGAATCCCTGCAGCTGG - Intergenic
1033184211 7:139211050-139211072 CCTCCCTTACCCCCAGCAGTAGG + Intergenic
1036066671 8:5388383-5388405 TGTTCCTGAAGCCCAGCACGTGG - Intergenic
1036649618 8:10634012-10634034 TCACCCTGATCCCCAGCTGCAGG + Intronic
1039417225 8:37406120-37406142 TCACCATGCACCCCAGGAGGAGG + Intergenic
1042219554 8:66460184-66460206 TCTCCCTAACGCCCAGCACGGGG - Intronic
1044729358 8:95217951-95217973 TCTCTGTGAACCCCAGATGGAGG - Intergenic
1047028600 8:120851574-120851596 GATCCCTGAACACCAGTAGGTGG - Intergenic
1047957127 8:129984557-129984579 CCTCCCTGTACCCCAGGATGCGG + Intronic
1048084747 8:131164708-131164730 TCTCCTTGAACACCAGCTTGGGG - Intergenic
1048112572 8:131484819-131484841 TCTCTCTGCTACCCAGCAGGAGG - Intergenic
1048527230 8:135214283-135214305 GCACCCAGAACCCCAGGAGGTGG + Intergenic
1048997834 8:139805039-139805061 TGCCCCTGGACCCCAGCATGAGG - Intronic
1050062976 9:1729793-1729815 TCTCCCTGAACGCCCTCAGAAGG + Intergenic
1051190032 9:14501722-14501744 TCTCATTGCACCCCTGCAGGGGG - Intergenic
1052466836 9:28839836-28839858 GCACCATGCACCCCAGCAGGAGG - Intergenic
1053005119 9:34599188-34599210 TCTCCCAGGCCCCCAGCAGCTGG + Intergenic
1053293676 9:36898687-36898709 GCTCTCCGAACACCAGCAGGAGG + Intronic
1056937979 9:90932346-90932368 CCTCCCTGAACCTCTGCAGAGGG + Intergenic
1057083290 9:92188485-92188507 CCTCCCTGGGCCCCAGCAGAGGG - Intergenic
1058671798 9:107366538-107366560 TGGCCCTGCTCCCCAGCAGGTGG - Intergenic
1060059686 9:120448039-120448061 TCTCCCTGCCACCCAGGAGGTGG - Exonic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1061263468 9:129492513-129492535 TCTGCCTGAACCCCAGCACCTGG + Intergenic
1061290363 9:129647315-129647337 AGGCCCTGAACACCAGCAGGGGG + Intergenic
1061622834 9:131823091-131823113 TTTCTCAGAACCCCAGGAGGTGG - Intergenic
1061801563 9:133115834-133115856 TCACCCTGAAACCCAGTGGGTGG + Intronic
1062274717 9:135725273-135725295 CCTCCCAGAACCCCAGAATGTGG + Intronic
1062350172 9:136134690-136134712 GCTCACTGAAGCCCAGGAGGTGG + Intergenic
1185654532 X:1673431-1673453 TCTCAATGAACACCAGGAGGCGG + Intergenic
1185868047 X:3640069-3640091 TCTCTCTGATTCCCTGCAGGGGG - Intronic
1186283121 X:8015820-8015842 TCTCCCTGCATCCCATCCGGTGG + Intergenic
1187031604 X:15493593-15493615 TCTCCCTGTCACCCAGCCGGCGG + Intronic
1188263320 X:28041898-28041920 TCTCCAGGAACACCAGCACGTGG + Intergenic
1189848587 X:45157977-45157999 TCTCCCTCACCCCCAACAGCAGG - Intronic
1190116025 X:47626836-47626858 TCACCCTGTGCCCCAGCATGGGG - Exonic
1195045319 X:101050157-101050179 TTGCCCTATACCCCAGCAGGAGG + Intronic
1196118571 X:112023842-112023864 TCTGCCCAAACCCCAGCAGAGGG + Intronic
1198189461 X:134287985-134288007 GCACCATGAACCGCAGCAGGAGG + Intergenic