ID: 1152209699

View in Genome Browser
Species Human (GRCh38)
Location 17:78996508-78996530
Sequence TCTCCCTGAACCCCAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152209699_1152209711 28 Left 1152209699 17:78996508-78996530 CCCCCTGCTGGGGTTCAGGGAGA 0: 1
1: 0
2: 1
3: 36
4: 291
Right 1152209711 17:78996559-78996581 GTAACATGAAACCAAAGTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 229
1152209699_1152209710 27 Left 1152209699 17:78996508-78996530 CCCCCTGCTGGGGTTCAGGGAGA 0: 1
1: 0
2: 1
3: 36
4: 291
Right 1152209710 17:78996558-78996580 AGTAACATGAAACCAAAGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152209699 Original CRISPR TCTCCCTGAACCCCAGCAGG GGG (reversed) Intronic