ID: 1152209857

View in Genome Browser
Species Human (GRCh38)
Location 17:78997318-78997340
Sequence CCCCCACAAAGGACACCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152209857_1152209866 9 Left 1152209857 17:78997318-78997340 CCAGCCGGTGTCCTTTGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1152209866 17:78997350-78997372 GTAGGTGTCATTGTACCAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1152209857_1152209867 12 Left 1152209857 17:78997318-78997340 CCAGCCGGTGTCCTTTGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1152209867 17:78997353-78997375 GGTGTCATTGTACCAGTTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 78
1152209857_1152209869 20 Left 1152209857 17:78997318-78997340 CCAGCCGGTGTCCTTTGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1152209869 17:78997361-78997383 TGTACCAGTTGGCGGGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1152209857_1152209865 -9 Left 1152209857 17:78997318-78997340 CCAGCCGGTGTCCTTTGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1152209865 17:78997332-78997354 TTGTGGGGGAGACAGGGGGTAGG 0: 1
1: 0
2: 1
3: 39
4: 583
1152209857_1152209868 13 Left 1152209857 17:78997318-78997340 CCAGCCGGTGTCCTTTGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1152209868 17:78997354-78997376 GTGTCATTGTACCAGTTGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152209857 Original CRISPR CCCCCACAAAGGACACCGGC TGG (reversed) Exonic
900124026 1:1061721-1061743 GCCCCACAAAGGGCAGCTGCAGG - Intergenic
901039205 1:6354160-6354182 CCTCCAGAGGGGACACCGGCCGG - Intronic
901068634 1:6506434-6506456 CCCCCACCGAGGAGACGGGCTGG + Intronic
906947638 1:50308990-50309012 CCTCGATAAAGGACACAGGCAGG - Intergenic
909684444 1:78330913-78330935 CCCCCCCAAAAGACACTGACTGG - Intronic
913645646 1:120851343-120851365 CCTCCCCAAAGGACAATGGCAGG - Intergenic
914081065 1:144412183-144412205 CCTCCCCAAAGGACAATGGCAGG + Intergenic
914175980 1:145280717-145280739 CCTCCCCAAAGGACAATGGCAGG + Intergenic
914530701 1:148522199-148522221 CCTCCCCAAAGGACAATGGCAGG + Intergenic
914674824 1:149900302-149900324 CCCCCTACAACGACACCGGCTGG + Exonic
915754615 1:158248051-158248073 CCCCCACATGGGACACCTGTTGG - Intergenic
919465474 1:197918593-197918615 CCCCTACACATGACACCCGCCGG - Intronic
920199433 1:204250482-204250504 CCCCCGCAGAGGACAGCAGCAGG + Intronic
920827237 1:209433556-209433578 CCCCCTCAGAGGTCACTGGCTGG - Intergenic
922979844 1:229816452-229816474 CCCCCAGCAAGGTCACCAGCAGG - Intergenic
1067180932 10:43985464-43985486 ACCCCATAAGGGACACCGACTGG + Intergenic
1069058027 10:63865109-63865131 CCCCCACAAAGCATACAGGATGG - Intergenic
1076426743 10:130372429-130372451 CCAGCACCAAGGACACAGGCTGG - Intergenic
1077154837 11:1086618-1086640 CTCCCACACAGGACACCTGCAGG - Intergenic
1078916482 11:15783511-15783533 GCCCCACCAAGGACACTGTCTGG - Intergenic
1079117493 11:17649617-17649639 CCCCCAGAAGGAACACAGGCTGG + Intergenic
1083850945 11:65366542-65366564 CCACCACAAAGGAAAGGGGCAGG + Intergenic
1084879152 11:72157790-72157812 CCCCCACAAAGGACAGTAGCAGG - Intergenic
1088653566 11:111977999-111978021 CCCCCACCAAAGACCCTGGCAGG - Intronic
1091812829 12:3414345-3414367 CCTCCAGAAGGGACACCTGCTGG + Intronic
1118749385 14:68795322-68795344 CCCCCAAAAAAGAGGCCGGCTGG + Intronic
1119583793 14:75812697-75812719 CCTCCACAAAGCTCACGGGCAGG - Intronic
1122995583 14:105262099-105262121 CACCCACACAGGAGCCCGGCAGG + Intronic
1123735548 15:23179911-23179933 CCCACACACAGGCTACCGGCAGG - Intergenic
1124147408 15:27140326-27140348 AACCCACAATGGACACCAGCTGG - Intronic
1124286263 15:28402894-28402916 CCCACACACAGGCTACCGGCGGG - Intergenic
1124296440 15:28508742-28508764 CCCACACACAGGCTACCGGCGGG + Intergenic
1128253749 15:66182110-66182132 CCCCCTCTAAGGACAACAGCAGG + Intronic
1129393784 15:75233610-75233632 CGGCCACAGAGGACACTGGCTGG + Intergenic
1130031130 15:80315254-80315276 CACCCTCAAAGGCCACAGGCAGG - Intergenic
1131512473 15:93056889-93056911 CCCCCACAAAGGCCACAGTGGGG + Intronic
1133069177 16:3234652-3234674 CCCGCCCAAAGGGCACCGGAGGG - Exonic
1133248243 16:4463373-4463395 CTCCCACAGAGGAGCCCGGCAGG + Intronic
1134558045 16:15183239-15183261 CCCCCAAAAATGACAGCAGCTGG - Intergenic
1139288888 16:65839547-65839569 CCCCCAGGAAGCACACAGGCTGG + Intergenic
1139673160 16:68505427-68505449 CCAGCACCAAGGACACCGACTGG - Intergenic
1140192057 16:72826205-72826227 CCCCCAAAAAGGAAACCAGGAGG + Intronic
1143966138 17:10757584-10757606 CCCCCTCAAACCACACCAGCAGG - Intergenic
1144673189 17:17144446-17144468 CCCCAACAGAGAACACCAGCAGG + Intronic
1145827783 17:27890223-27890245 ACCCCACAAAGAACTCTGGCAGG + Intronic
1148895121 17:50835133-50835155 CCCCCACAAAGGGCCGGGGCCGG + Intronic
1150452382 17:65279594-65279616 CCCCCACCAATCACACCAGCAGG - Intergenic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1157523145 18:48359124-48359146 CCCCAACAAAGGGCACAGGAAGG + Intronic
1161320605 19:3639077-3639099 CCCCCACTCAGGACCCAGGCAGG + Intronic
1163509735 19:17727475-17727497 CCTGCTCAAAGGACACCGACAGG - Exonic
1163822399 19:19503361-19503383 CCCTCACTTAGGACAGCGGCAGG - Intronic
1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG + Intergenic
1167305087 19:48703526-48703548 CCCCTACAAAGGTGCCCGGCCGG - Exonic
1168655936 19:58127953-58127975 TCCACACTGAGGACACCGGCTGG + Exonic
1168708027 19:58480693-58480715 CCACCGCAAGGGCCACCGGCCGG + Exonic
926244370 2:11112390-11112412 CCCCCAAAATGCACACCTGCAGG + Intergenic
929282740 2:40100115-40100137 CCACCACAAAGGACACTGAAAGG + Intronic
935818239 2:106867900-106867922 CCCCCACAAAAGCCACTGTCTGG + Intronic
947303505 2:228716624-228716646 TCCCTACAAAGGACACAGGAAGG - Intergenic
948194597 2:236085811-236085833 CCTTCACAAAGGAAGCCGGCTGG - Intronic
948211008 2:236193190-236193212 CTCCCCCGGAGGACACCGGCAGG - Intergenic
948420974 2:237859770-237859792 CTCCCCTAGAGGACACCGGCTGG - Intronic
948633428 2:239317254-239317276 GCCTCACAAAGGCCACCGGCTGG - Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1176102430 20:63370549-63370571 CACCCACCAAGGACCCAGGCCGG - Intronic
1176187993 20:63791985-63792007 CCTCCACACAGAACGCCGGCTGG - Intronic
1177641629 21:23850736-23850758 CCCCCAAAAAGCACACCTGCTGG + Intergenic
1179718908 21:43304469-43304491 CCACCACAAAGGACCCCAGCCGG - Intergenic
1183212501 22:36459521-36459543 CTCCCACAAAGTAAACCGGCAGG + Intergenic
1183937367 22:41270876-41270898 CCCTCACAACAGATACCGGCAGG + Intronic
1184556546 22:45236299-45236321 GCCCCACAAATCACACCTGCAGG + Intronic
1185273230 22:49938094-49938116 CCCCCAGGAAGGCCACTGGCTGG - Intergenic
950124068 3:10500916-10500938 CCCTCACCAAGGACACTGGGGGG + Intronic
954583796 3:51717906-51717928 GCCCCCCAAATGACACTGGCAGG + Intronic
958726651 3:97913722-97913744 CCCAAACAAATGACACCTGCTGG - Intronic
965723586 3:171688780-171688802 CTCCCACAAAGGCCACCGATTGG + Exonic
966299452 3:178462132-178462154 CCCCCACACAGAACACCTACTGG + Intronic
970674766 4:18436333-18436355 CCACCACAAAGAACAACAGCAGG - Intergenic
984709556 4:182873835-182873857 CCCGCAGAAAGGTCACCGACAGG + Intergenic
992350291 5:75921346-75921368 ACCCCCCAAAGGACAGCAGCAGG - Intergenic
997461425 5:134055139-134055161 CAGCCACAAAGGAGACAGGCTGG + Intergenic
999202503 5:149826313-149826335 CCCCCACCAAGGACAGAGGCTGG - Intronic
1002598502 5:180339800-180339822 TCCCCACCAAGGGCACAGGCTGG + Intronic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1019370294 7:659626-659648 CCGCGACCATGGACACCGGCAGG + Intronic
1023859982 7:44212779-44212801 CCACCACAGAGGCCACAGGCAGG + Exonic
1026587410 7:71667691-71667713 CCCACACAAAGCACATGGGCAGG + Intronic
1032169735 7:129574722-129574744 GCCCCACAGAGGACAGCTGCTGG + Intergenic
1033078111 7:138268302-138268324 CCTCCACAAATGGCACCAGCAGG + Intergenic
1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG + Intronic
1036676601 8:10839423-10839445 ACCCCACAAAGGGCGGCGGCGGG + Intronic
1038380078 8:27084556-27084578 CCCCCATAAAGGCCAGCGGAGGG + Intergenic
1045265231 8:100613305-100613327 CCACCACAATGGACAGAGGCTGG + Intronic
1051444038 9:17121434-17121456 ACATCACAAAGAACACCGGCTGG - Intergenic
1060378680 9:123143270-123143292 CCCCCACAAAGGATACCTTTAGG - Intronic
1061416093 9:130447640-130447662 CCCCCAGAAAGGGCCACGGCAGG - Intronic
1198806789 X:140501868-140501890 CCCACACAAAGGAAGCCGGCTGG + Intergenic
1200908420 Y:8509374-8509396 CCCCCACAGAGGACACAGGCTGG - Intergenic
1202047633 Y:20750515-20750537 CCCCCAGAAGGGGCACAGGCAGG - Intergenic