ID: 1152214114

View in Genome Browser
Species Human (GRCh38)
Location 17:79022613-79022635
Sequence AATGGAGACAAGCTTATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152214109_1152214114 21 Left 1152214109 17:79022569-79022591 CCTTGCTCCTGGTGACTGGGAAA No data
Right 1152214114 17:79022613-79022635 AATGGAGACAAGCTTATCTCTGG No data
1152214110_1152214114 14 Left 1152214110 17:79022576-79022598 CCTGGTGACTGGGAAACTTCCTC No data
Right 1152214114 17:79022613-79022635 AATGGAGACAAGCTTATCTCTGG No data
1152214112_1152214114 -5 Left 1152214112 17:79022595-79022617 CCTCATGTCACTTACAGGAATGG No data
Right 1152214114 17:79022613-79022635 AATGGAGACAAGCTTATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152214114 Original CRISPR AATGGAGACAAGCTTATCTC TGG Intergenic
No off target data available for this crispr